ID: 1081755793

View in Genome Browser
Species Human (GRCh38)
Location 11:45543418-45543440
Sequence CAGAACCCCCAACAGGTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081755787_1081755793 -6 Left 1081755787 11:45543401-45543423 CCCCAGGCCAGGTGTGCCAGAAC No data
Right 1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG No data
1081755788_1081755793 -7 Left 1081755788 11:45543402-45543424 CCCAGGCCAGGTGTGCCAGAACC No data
Right 1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG No data
1081755782_1081755793 26 Left 1081755782 11:45543369-45543391 CCTTCTTGGCATGGCTGTGAAGA No data
Right 1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG No data
1081755786_1081755793 -2 Left 1081755786 11:45543397-45543419 CCTGCCCCAGGCCAGGTGTGCCA No data
Right 1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG No data
1081755781_1081755793 27 Left 1081755781 11:45543368-45543390 CCCTTCTTGGCATGGCTGTGAAG No data
Right 1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG No data
1081755789_1081755793 -8 Left 1081755789 11:45543403-45543425 CCAGGCCAGGTGTGCCAGAACCC No data
Right 1081755793 11:45543418-45543440 CAGAACCCCCAACAGGTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081755793 Original CRISPR CAGAACCCCCAACAGGTGCA AGG Intergenic
No off target data available for this crispr