ID: 1081755841

View in Genome Browser
Species Human (GRCh38)
Location 11:45543874-45543896
Sequence TGCCACAGGGAACTGTTATG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081755837_1081755841 12 Left 1081755837 11:45543839-45543861 CCATGGACAATGAAGTAAGTGAT No data
Right 1081755841 11:45543874-45543896 TGCCACAGGGAACTGTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081755841 Original CRISPR TGCCACAGGGAACTGTTATG TGG Intergenic
No off target data available for this crispr