ID: 1081756605

View in Genome Browser
Species Human (GRCh38)
Location 11:45549286-45549308
Sequence GGTCCCAGGGACGCCTGTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081756605_1081756618 22 Left 1081756605 11:45549286-45549308 CCATCACAGGCGTCCCTGGGACC No data
Right 1081756618 11:45549331-45549353 CAGGGGCATCCCTCTGCAGCTGG No data
1081756605_1081756613 3 Left 1081756605 11:45549286-45549308 CCATCACAGGCGTCCCTGGGACC No data
Right 1081756613 11:45549312-45549334 TCCCAGTGGGATGCAGGGTCAGG No data
1081756605_1081756612 -2 Left 1081756605 11:45549286-45549308 CCATCACAGGCGTCCCTGGGACC No data
Right 1081756612 11:45549307-45549329 CCTTCTCCCAGTGGGATGCAGGG No data
1081756605_1081756615 4 Left 1081756605 11:45549286-45549308 CCATCACAGGCGTCCCTGGGACC No data
Right 1081756615 11:45549313-45549335 CCCAGTGGGATGCAGGGTCAGGG No data
1081756605_1081756617 5 Left 1081756605 11:45549286-45549308 CCATCACAGGCGTCCCTGGGACC No data
Right 1081756617 11:45549314-45549336 CCAGTGGGATGCAGGGTCAGGGG No data
1081756605_1081756610 -3 Left 1081756605 11:45549286-45549308 CCATCACAGGCGTCCCTGGGACC No data
Right 1081756610 11:45549306-45549328 ACCTTCTCCCAGTGGGATGCAGG No data
1081756605_1081756608 -10 Left 1081756605 11:45549286-45549308 CCATCACAGGCGTCCCTGGGACC No data
Right 1081756608 11:45549299-45549321 CCCTGGGACCTTCTCCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081756605 Original CRISPR GGTCCCAGGGACGCCTGTGA TGG (reversed) Intergenic
No off target data available for this crispr