ID: 1081758377

View in Genome Browser
Species Human (GRCh38)
Location 11:45560410-45560432
Sequence GGACCGTGCTTGGCTGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081758369_1081758377 -3 Left 1081758369 11:45560390-45560412 CCCAAACCCCTCTCCCTTGAGGA No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758362_1081758377 24 Left 1081758362 11:45560363-45560385 CCCTCGCCTCCCTGGAAGTCTCT No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758370_1081758377 -4 Left 1081758370 11:45560391-45560413 CCAAACCCCTCTCCCTTGAGGAC No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758366_1081758377 14 Left 1081758366 11:45560373-45560395 CCTGGAAGTCTCTCCTGCCCAAA No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758365_1081758377 15 Left 1081758365 11:45560372-45560394 CCCTGGAAGTCTCTCCTGCCCAA No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758363_1081758377 23 Left 1081758363 11:45560364-45560386 CCTCGCCTCCCTGGAAGTCTCTC No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758367_1081758377 1 Left 1081758367 11:45560386-45560408 CCTGCCCAAACCCCTCTCCCTTG No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758372_1081758377 -10 Left 1081758372 11:45560397-45560419 CCCTCTCCCTTGAGGACCGTGCT No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758371_1081758377 -9 Left 1081758371 11:45560396-45560418 CCCCTCTCCCTTGAGGACCGTGC No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data
1081758364_1081758377 18 Left 1081758364 11:45560369-45560391 CCTCCCTGGAAGTCTCTCCTGCC No data
Right 1081758377 11:45560410-45560432 GGACCGTGCTTGGCTGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081758377 Original CRISPR GGACCGTGCTTGGCTGCTGC AGG Intergenic
No off target data available for this crispr