ID: 1081775580

View in Genome Browser
Species Human (GRCh38)
Location 11:45674132-45674154
Sequence GCTTAGATCATGGTTCTCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081775580_1081775584 29 Left 1081775580 11:45674132-45674154 CCACTGAGAACCATGATCTAAGC No data
Right 1081775584 11:45674184-45674206 CTTGGGCGCAGCCTTCCAGAAGG No data
1081775580_1081775582 11 Left 1081775580 11:45674132-45674154 CCACTGAGAACCATGATCTAAGC No data
Right 1081775582 11:45674166-45674188 GCAGTTTACAAAGTGCTGCTTGG No data
1081775580_1081775583 12 Left 1081775580 11:45674132-45674154 CCACTGAGAACCATGATCTAAGC No data
Right 1081775583 11:45674167-45674189 CAGTTTACAAAGTGCTGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081775580 Original CRISPR GCTTAGATCATGGTTCTCAG TGG (reversed) Intergenic