ID: 1081776330

View in Genome Browser
Species Human (GRCh38)
Location 11:45678276-45678298
Sequence GTGTCAAAACGGCAGGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081776330_1081776337 7 Left 1081776330 11:45678276-45678298 CCCTCCACCTGCCGTTTTGACAC No data
Right 1081776337 11:45678306-45678328 ATGCCTGTGGCTTCCAGAGGTGG No data
1081776330_1081776339 13 Left 1081776330 11:45678276-45678298 CCCTCCACCTGCCGTTTTGACAC No data
Right 1081776339 11:45678312-45678334 GTGGCTTCCAGAGGTGGCCCTGG No data
1081776330_1081776336 4 Left 1081776330 11:45678276-45678298 CCCTCCACCTGCCGTTTTGACAC No data
Right 1081776336 11:45678303-45678325 TCAATGCCTGTGGCTTCCAGAGG No data
1081776330_1081776335 -6 Left 1081776330 11:45678276-45678298 CCCTCCACCTGCCGTTTTGACAC No data
Right 1081776335 11:45678293-45678315 TGACACTGACTCAATGCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081776330 Original CRISPR GTGTCAAAACGGCAGGTGGA GGG (reversed) Intergenic
No off target data available for this crispr