ID: 1081776886

View in Genome Browser
Species Human (GRCh38)
Location 11:45681750-45681772
Sequence CATGGATCCCAGCACCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081776886_1081776892 10 Left 1081776886 11:45681750-45681772 CCATGGGGGTGCTGGGATCCATG No data
Right 1081776892 11:45681783-45681805 GAGACCCCAAACAGACACCCAGG No data
1081776886_1081776893 11 Left 1081776886 11:45681750-45681772 CCATGGGGGTGCTGGGATCCATG No data
Right 1081776893 11:45681784-45681806 AGACCCCAAACAGACACCCAGGG No data
1081776886_1081776900 30 Left 1081776886 11:45681750-45681772 CCATGGGGGTGCTGGGATCCATG No data
Right 1081776900 11:45681803-45681825 AGGGCCAGTTGACTTGACCTGGG No data
1081776886_1081776899 29 Left 1081776886 11:45681750-45681772 CCATGGGGGTGCTGGGATCCATG No data
Right 1081776899 11:45681802-45681824 CAGGGCCAGTTGACTTGACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081776886 Original CRISPR CATGGATCCCAGCACCCCCA TGG (reversed) Intergenic
No off target data available for this crispr