ID: 1081778113

View in Genome Browser
Species Human (GRCh38)
Location 11:45690952-45690974
Sequence GTCCAAGTTAGGCCTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081778113_1081778117 -7 Left 1081778113 11:45690952-45690974 CCATGCCCAGGCCTAACTTGGAC No data
Right 1081778117 11:45690968-45690990 CTTGGACTCACTCCCACCTATGG No data
1081778113_1081778127 27 Left 1081778113 11:45690952-45690974 CCATGCCCAGGCCTAACTTGGAC No data
Right 1081778127 11:45691002-45691024 TTTTTCAGGAACTGGAAAGGAGG No data
1081778113_1081778122 13 Left 1081778113 11:45690952-45690974 CCATGCCCAGGCCTAACTTGGAC No data
Right 1081778122 11:45690988-45691010 TGGGACCCTTGCTCTTTTTCAGG No data
1081778113_1081778118 -6 Left 1081778113 11:45690952-45690974 CCATGCCCAGGCCTAACTTGGAC No data
Right 1081778118 11:45690969-45690991 TTGGACTCACTCCCACCTATGGG No data
1081778113_1081778126 24 Left 1081778113 11:45690952-45690974 CCATGCCCAGGCCTAACTTGGAC No data
Right 1081778126 11:45690999-45691021 CTCTTTTTCAGGAACTGGAAAGG No data
1081778113_1081778125 19 Left 1081778113 11:45690952-45690974 CCATGCCCAGGCCTAACTTGGAC No data
Right 1081778125 11:45690994-45691016 CCTTGCTCTTTTTCAGGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081778113 Original CRISPR GTCCAAGTTAGGCCTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr