ID: 1081782729

View in Genome Browser
Species Human (GRCh38)
Location 11:45724342-45724364
Sequence CAGGGTAACCCATCTGTAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 74}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081782729 Original CRISPR CAGGGTAACCCATCTGTAGT AGG (reversed) Intergenic
904556620 1:31369076-31369098 CAGGGTCACCCAGCTGGAGCTGG + Intronic
906424209 1:45696397-45696419 CTGGGTTACCAAACTGTAGTAGG - Intronic
907506516 1:54923015-54923037 CAGGCTAACCCAGCTGGAGCCGG + Intergenic
911420645 1:97636397-97636419 CAGGGTAACACAGCTGTAAGCGG - Intronic
913099261 1:115547960-115547982 CAAGGAAATCCATCTGCAGTTGG - Intergenic
915978342 1:160405212-160405234 CAGGGTTACCCACCTGTGGAAGG - Intronic
917263576 1:173195870-173195892 GAGGGAAACACATCTGGAGTGGG + Intronic
917675008 1:177310524-177310546 CAGAGTCACCCAGCTATAGTTGG - Intergenic
917711025 1:177685442-177685464 CAGGGTCCCACCTCTGTAGTGGG - Intergenic
919772650 1:201172549-201172571 CAGGCTAAGCCAGCTGCAGTTGG - Intergenic
1063775951 10:9264350-9264372 CAGGGTAAACCTTCAATAGTTGG - Intergenic
1065264631 10:23962092-23962114 CAGGGCAACACATTTGTAATGGG - Intronic
1070699806 10:78593457-78593479 CTGGGTCACCCATCTGTCCTTGG - Intergenic
1071745611 10:88415820-88415842 CAGGTTAACCCATCTGTGCATGG - Intronic
1074516417 10:114174309-114174331 CTGGGTAACCTGTCTGCAGTGGG + Intergenic
1081782729 11:45724342-45724364 CAGGGTAACCCATCTGTAGTAGG - Intergenic
1087716296 11:101612619-101612641 CAGGGTCACCCATCGGAAGTTGG - Intronic
1088550026 11:111003502-111003524 TAGGTTAACCCATATTTAGTAGG + Intergenic
1091103842 11:132899982-132900004 CAGGGTCCCCCATATGTAGACGG + Intronic
1094278974 12:28713557-28713579 CAGTGCCACCCATCTGTACTGGG - Intergenic
1096115842 12:49054564-49054586 CAGGGAAACCAATCTGTGATAGG + Exonic
1099585447 12:84507636-84507658 CAGGGCAATCCCTCTGTAATAGG + Intergenic
1101649923 12:106668104-106668126 GAAGGTAACCCAGCTGCAGTTGG + Intronic
1104921683 12:132293909-132293931 CAGGGGACCCCATCTACAGTCGG + Intronic
1108073368 13:46652682-46652704 CAGGGGAAAGCATGTGTAGTTGG + Intronic
1113091161 13:106618576-106618598 CAGGGCACAGCATCTGTAGTAGG - Intergenic
1113562128 13:111289971-111289993 CTGGGTAACCCATCAGAAGGTGG + Intronic
1120233897 14:81868760-81868782 CACGGCAACCAATTTGTAGTAGG - Intergenic
1126147383 15:45488636-45488658 CAGGGTAACTTATCTGTATTTGG - Intronic
1128285041 15:66429685-66429707 CAGGCTAGCCCATCTGTGTTGGG - Intronic
1128311573 15:66634282-66634304 CAGGGCCACCCATTTGTAGGCGG + Intronic
1140231951 16:73124629-73124651 CAGGGTCACACATCTGTATTAGG + Intergenic
1141228027 16:82137834-82137856 AAATGTAAACCATCTGTAGTAGG + Intergenic
1146178961 17:30685157-30685179 CAGGGTGACCCTTCTGAAGGGGG + Intergenic
1155858186 18:30861978-30862000 CAAGGAAAACCTTCTGTAGTTGG - Intergenic
1161131007 19:2588688-2588710 CTGGGTAACCCAGCTGGGGTTGG - Intronic
1162979652 19:14230397-14230419 CAGGGTGACCCTTCTGAAGGGGG - Intergenic
1164992418 19:32693869-32693891 CAGGGCACCCCATCTGCTGTTGG + Intronic
1165183247 19:33991305-33991327 CAGGGTAACCCCTCAGTCTTGGG - Intergenic
926120245 2:10237804-10237826 CAAGGTCACCCATCTGGTGTTGG + Intergenic
928641208 2:33301898-33301920 CAGGATAAACCATCTATAGCTGG - Intronic
931009260 2:57889329-57889351 CAGGGAAGCCCATATGCAGTGGG - Intergenic
932798859 2:74721916-74721938 CAGGCAAACCCATCTGTTCTGGG - Intergenic
935730364 2:106060050-106060072 CAGGGTTCTCCCTCTGTAGTGGG + Intergenic
947712074 2:232321981-232322003 CAGGGTCACCCATCTGAACCTGG - Intronic
947731315 2:232433100-232433122 CAGGGTCACCCATCTGAACCTGG - Intergenic
1170273420 20:14554411-14554433 CTGTGCAACCCATCTGTGGTGGG + Intronic
1177918968 21:27126271-27126293 AAGGTTATGCCATCTGTAGTAGG + Intergenic
1181579739 22:23821370-23821392 CAGGGTTTCCCATCTATAATTGG + Intronic
949654933 3:6207041-6207063 CAGGGGAACCCTTTTATAGTAGG - Intergenic
950142610 3:10625674-10625696 CAGGGCTACCCCTCTGTGGTGGG + Intronic
953395306 3:42564651-42564673 CAGGGTAACTCACCTCTACTTGG - Intronic
956711914 3:72046618-72046640 CAGTGTAGCCCATCTGGAATTGG - Intergenic
962536366 3:136332867-136332889 AAGGGAAAGCCATCAGTAGTGGG - Intronic
964262930 3:154860525-154860547 CAGGGTAACACACATATAGTAGG - Intergenic
967934200 3:194713629-194713651 CAGGGTAAAACCTCTGAAGTGGG + Intergenic
969371041 4:6731836-6731858 CAGGGTACCCCCTCTGCAGAAGG - Intergenic
973045616 4:45532237-45532259 CAGGGTCAACCAACTGTTGTTGG - Intergenic
973729324 4:53808474-53808496 CATGGAAGCCCATATGTAGTTGG - Intronic
974013096 4:56625071-56625093 CATGGGAACCCATCTCTTGTGGG + Intergenic
979000357 4:115209751-115209773 CAGAGTAACCCAGATGGAGTTGG + Intergenic
981478316 4:145210369-145210391 CAGGGTATCCCATGTTTACTAGG - Intergenic
983526396 4:168764551-168764573 CAGTGGCACACATCTGTAGTCGG - Intronic
983843626 4:172488327-172488349 CAGGGGAAGCCATCTTTACTAGG - Intronic
1011189149 6:84712479-84712501 CAGGGAAACCCAAGTGTTGTTGG + Intronic
1012922508 6:105234349-105234371 CAGGGTACCTCATCTGCAGTTGG + Intergenic
1012991558 6:105931475-105931497 CAAGGTTACCCACCTGGAGTTGG + Intergenic
1014250403 6:119110135-119110157 CTGGGCTACCCATCTGTAGGTGG - Intronic
1017014163 6:150086402-150086424 CAGGGTCACCCAGCAATAGTGGG - Intergenic
1021861889 7:24914055-24914077 CAGGGAAGCCCATTTGTGGTGGG - Intronic
1035704579 8:1665817-1665839 CATGGTAACCCATTTGTCATGGG - Intronic
1039116388 8:34095770-34095792 CAGGGTCACCCCTGTGTAATGGG - Intergenic
1043145659 8:76650563-76650585 CAGTGTCACGCACCTGTAGTTGG - Intergenic
1046647371 8:116800893-116800915 CAGGGAACCCCATCTGGGGTTGG + Intronic
1050751082 9:8938142-8938164 CAGGGTAACCAATTTGTTGATGG + Intronic
1060911831 9:127357374-127357396 CAGGGTAAGCCAGCGGTTGTGGG + Exonic
1061256842 9:129458583-129458605 CAGGGTCACCCAGCTGTTGATGG - Intergenic
1061574822 9:131499610-131499632 CAGGGCCACCAATGTGTAGTTGG + Exonic
1187524450 X:20041703-20041725 CAGTGGAAACCATCTTTAGTAGG - Intronic