ID: 1081789401

View in Genome Browser
Species Human (GRCh38)
Location 11:45772147-45772169
Sequence CTGGCTTTCTCCTGCTCCCC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 591
Summary {0: 1, 1: 2, 2: 5, 3: 67, 4: 516}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081789393_1081789401 6 Left 1081789393 11:45772118-45772140 CCTCCAGCGGCGCTGGGTCCCCA 0: 1
1: 0
2: 2
3: 12
4: 204
Right 1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG 0: 1
1: 2
2: 5
3: 67
4: 516
1081789394_1081789401 3 Left 1081789394 11:45772121-45772143 CCAGCGGCGCTGGGTCCCCATGG 0: 1
1: 0
2: 0
3: 7
4: 134
Right 1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG 0: 1
1: 2
2: 5
3: 67
4: 516
1081789392_1081789401 7 Left 1081789392 11:45772117-45772139 CCCTCCAGCGGCGCTGGGTCCCC 0: 1
1: 0
2: 2
3: 11
4: 164
Right 1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG 0: 1
1: 2
2: 5
3: 67
4: 516
1081789388_1081789401 29 Left 1081789388 11:45772095-45772117 CCTCAGCTGTGTGCTGGTGCTGC 0: 1
1: 0
2: 4
3: 45
4: 302
Right 1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG 0: 1
1: 2
2: 5
3: 67
4: 516

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081789401 Original CRISPR CTGGCTTTCTCCTGCTCCCC AGG Exonic
900226130 1:1534406-1534428 CTGCCTGGCTCCTGCTGCCCCGG - Exonic
900408687 1:2503389-2503411 CTGGGCGTCTCCTGCGCCCCTGG + Intronic
900447412 1:2688251-2688273 CAGGCTGTCACATGCTCCCCTGG - Intronic
900454718 1:2768583-2768605 CAGGCTTTCAGCTGCTCACCTGG - Intronic
900456234 1:2776208-2776230 CAGGCTTTCAGCTGCTCACCTGG - Intronic
900539089 1:3193860-3193882 CTGTATTTCCCATGCTCCCCAGG - Intronic
900550274 1:3251142-3251164 CTGGCTTGGTCCGGCTCCTCTGG - Intronic
900617274 1:3571086-3571108 CTCTCTGTGTCCTGCTCCCCAGG - Intronic
900794337 1:4698958-4698980 CTGCCTTGCTCCTGGTTCCCCGG + Intronic
900979719 1:6039429-6039451 CTGTCTTTCACCTGAACCCCTGG - Intronic
901069509 1:6510043-6510065 CTGGCTCTCCCCGGCTGCCCTGG - Intronic
901194801 1:7434344-7434366 CTGGCCTTCTCCATCTCGCCAGG + Intronic
902178632 1:14670525-14670547 GGGGCTTTCACCTGCTCCCCAGG - Intronic
903222895 1:21878706-21878728 CAGGCTTTCTCCTCCCACCCTGG + Intronic
903393173 1:22979359-22979381 CAGGTTTTCTTCTGCTACCCTGG - Intergenic
903522244 1:23959642-23959664 CCGGCATGCTCCTCCTCCCCGGG + Intronic
903867423 1:26409838-26409860 TTGGGTTCCTCCTGCTCTCCAGG + Intergenic
903943310 1:26946311-26946333 CAGCCTTTCTCCTGATGCCCCGG - Exonic
904216432 1:28924027-28924049 CTGGCTTTCTCCCTCTCCCTGGG + Intronic
904342906 1:29849332-29849354 CTGGCCTTCCCATGCCCCCCAGG - Intergenic
904682990 1:32241607-32241629 CTGGCCTTCTGCTGGGCCCCGGG - Intergenic
904882988 1:33714670-33714692 TTGACCTTCTCCTGCTTCCCCGG - Exonic
904970317 1:34414341-34414363 CCTGCTTTCTCCTGCTGCTCAGG + Intergenic
905029244 1:34870474-34870496 CAGCCTTTCTCTTGCTGCCCAGG + Intronic
905128974 1:35737720-35737742 CTGGCTTTCTCTAGTTGCCCAGG - Intronic
905219248 1:36432782-36432804 CTGGCTTACTCCTGTTTTCCTGG - Intronic
905313427 1:37066143-37066165 ATGGCTTCCTCCTCCTCTCCCGG + Intergenic
905694038 1:39961938-39961960 AGGGCTTTCTACAGCTCCCCTGG + Intronic
905808798 1:40896888-40896910 CTGGCCTGCTCCTAGTCCCCAGG - Intergenic
905904913 1:41611721-41611743 CTGGCTTTCTCCCACTGTCCTGG + Intronic
906574504 1:46875748-46875770 CTGGCTTTGTCTTGCTGCCTGGG - Intergenic
906597469 1:47092157-47092179 CTGGCTTTGTCTTGCTGCCTGGG + Intronic
911254837 1:95621389-95621411 CTGGAGTTCTCCTCCTCCCTGGG - Intergenic
911536619 1:99107627-99107649 CTCTCTCTCTCCTGCTCCACAGG + Intergenic
912631462 1:111249968-111249990 CTGGCTCCCTCATCCTCCCCAGG + Intergenic
913502947 1:119488667-119488689 CTGGTTTTCTCATGGTACCCAGG - Intergenic
914671985 1:149877828-149877850 AGGGCTTTCTCCAGCTCCTCTGG - Intronic
915055255 1:153123173-153123195 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
915999955 1:160606132-160606154 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
916168059 1:161980921-161980943 CTGACGATCTCCTGGTCCCCTGG - Intergenic
916171698 1:162005934-162005956 CTGGTTTACTCCTGCTGTCCTGG - Intronic
916578193 1:166085665-166085687 TTGCCTTTCTCCTGCCTCCCTGG + Intronic
916586769 1:166156124-166156146 CTGGCTGGCTCCTGCTCCTGGGG - Intronic
917523592 1:175768105-175768127 TTGGCTTTCTTCTACTCACCTGG - Intergenic
917654933 1:177116896-177116918 CTTGCTTTCCACTCCTCCCCAGG + Intronic
917928405 1:179807456-179807478 CTGGCTTTCTCCTGCTCCACTGG - Intronic
918007446 1:180555165-180555187 CTTGCTATCTCCTGCTGCTCAGG - Intergenic
919481414 1:198094502-198094524 CTGGCCTTCTCCATCTCACCTGG + Intergenic
919654522 1:200184498-200184520 CAGGCTTTCTCTCTCTCCCCAGG - Intergenic
920330526 1:205204052-205204074 CTTGCTATCTCCTGCTCCCTGGG - Intronic
920496499 1:206458696-206458718 CTGACTGACTCCTCCTCCCCAGG + Exonic
920682585 1:208084235-208084257 CTGGCTGGCTCCTGCATCCCTGG + Intronic
921138907 1:212286372-212286394 CTGGGTTTCTCCTGCTCAGTTGG + Intronic
922098615 1:222463543-222463565 CTCTCCTTCTCCTGCTTCCCCGG - Intergenic
922616665 1:226964922-226964944 CTGCCTGTCCCCTGCTGCCCAGG - Intronic
923009229 1:230074971-230074993 CTGGCTTGCTCCTGCTCCCTGGG + Intronic
923100268 1:230808753-230808775 CTGGCATTCCCCTGCCTCCCTGG + Intergenic
923116795 1:230947874-230947896 CTGGCATCCTCCTGCTCTCCAGG + Intronic
923627402 1:235625184-235625206 CTTGCTTTCTCCTCTTGCCCTGG + Intronic
924768112 1:247053057-247053079 CTGGCTTTCTCCCACTTCCCTGG - Intronic
924828022 1:247562378-247562400 CAGGTTTCCTCCTGCTTCCCAGG + Intronic
924880194 1:248152574-248152596 CTGGCTTTCTGCTACTTCTCTGG - Intergenic
924883301 1:248186998-248187020 CTGGCTTTCTCTCACTTCCCTGG - Intergenic
1062884448 10:1005476-1005498 CTTGCGTTTTTCTGCTCCCCAGG + Intronic
1062904295 10:1169620-1169642 CTTTCTTTCCCCTGCTGCCCTGG - Intergenic
1062994396 10:1852283-1852305 CTGACCTCCTCCTGCTCCCTGGG + Intergenic
1063188608 10:3671994-3672016 CTGACTTTCAGCTACTCCCCAGG - Intergenic
1063437705 10:6048091-6048113 CTGGCTGCATCCTGCTCCCGTGG + Intronic
1063786793 10:9393951-9393973 ATTGCTTCCTCCTACTCCCCTGG + Intergenic
1064818108 10:19290374-19290396 CTCCCTTTCTCCTGCTCAGCAGG + Intronic
1065305776 10:24367097-24367119 CTTGTTTTCTCCTGGTCCACAGG + Intronic
1065692280 10:28346958-28346980 CTTTCTTTCTTCTGTTCCCCAGG - Intergenic
1066299859 10:34087081-34087103 CTGGCTCCCTCCTGCTTCACTGG + Intergenic
1066341649 10:34540135-34540157 CTGCCTGCCTCCTGCTTCCCAGG + Intronic
1066374678 10:34846919-34846941 CTGTCTCTCTCCTTCTCCTCGGG + Intergenic
1067011507 10:42718246-42718268 CTGGATGTCACCTCCTCCCCCGG + Intergenic
1067031506 10:42880904-42880926 CTGGCCCCCTCCTGCTCCCTGGG + Intergenic
1067523984 10:47027474-47027496 CTGGCTCTCTCCCTCTCCCCAGG - Intergenic
1069085637 10:64136604-64136626 TTGGCAATCTCCTTCTCCCCAGG + Intergenic
1069129594 10:64682223-64682245 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1069795435 10:71048905-71048927 CTGCCTGTCTCCTGCCCCTCAGG - Intergenic
1069863267 10:71484351-71484373 TCCTCTTTCTCCTGCTCCCCTGG - Intronic
1069870069 10:71527667-71527689 CTGGCTAACTCCTGGTGCCCTGG - Intronic
1070338924 10:75479057-75479079 CTGGTTTCCTCCAGCTCCCAGGG + Intronic
1070607926 10:77912391-77912413 CTGGTGGTCTCCTGCTCCCAGGG + Intronic
1070796368 10:79219238-79219260 CTGAGTCTCTCCTGCTCCTCTGG - Intronic
1070810071 10:79293206-79293228 CTGGGTGGATCCTGCTCCCCTGG + Intronic
1071301898 10:84262155-84262177 CTTGCTTTCTCCTGCCTCCACGG - Intergenic
1071361836 10:84854597-84854619 TAGCCTTTCTCCAGCTCCCCAGG - Intergenic
1071561907 10:86651760-86651782 CTGGGCATCTCCTCCTCCCCCGG - Intergenic
1073844889 10:107544259-107544281 CGGAGTTTCTCTTGCTCCCCAGG + Intergenic
1074274108 10:111984568-111984590 CTAGTCTTCTCCTGCTTCCCTGG + Intergenic
1074780576 10:116799147-116799169 CTGGCTTTGCCCTGATCCTCAGG + Intergenic
1076055097 10:127366424-127366446 CTGGCCTTTGCTTGCTCCCCTGG + Intronic
1076180355 10:128402276-128402298 CTGGCATTCTCCTGATCACAGGG + Intergenic
1076203028 10:128573104-128573126 CTGCCTGTCCCCTGCTCCCCTGG - Intergenic
1077010376 11:376775-376797 CTGGCGTCTTCCTGCACCCCAGG + Exonic
1077337767 11:2013029-2013051 CTGGCCTTCTCCTGGCCCCACGG + Intergenic
1078376116 11:10794656-10794678 CTGGCTTTCTCCCCCTCCTCAGG - Intergenic
1078554753 11:12313384-12313406 CTGACCTTCTCCTGCTCTCCTGG - Intronic
1079115675 11:17639233-17639255 CAGGCCTTCTCCTGCCCCCAGGG + Intronic
1080587740 11:33696838-33696860 CAGGCTTTCTCCTGAACTCCAGG + Intergenic
1081789401 11:45772147-45772169 CTGGCTTTCTCCTGCTCCCCAGG + Exonic
1083221305 11:61254563-61254585 CTGCCTTTCTGCTTGTCCCCAGG - Intergenic
1083310598 11:61781704-61781726 TTGGCTTTGCCCTGCCCCCCAGG - Exonic
1083640949 11:64145008-64145030 CTGGCCTGCTCCTTCTCACCAGG + Intronic
1084041212 11:66543720-66543742 CTGCCCTCCTCCTGCTTCCCTGG - Exonic
1084323294 11:68385321-68385343 CTGGGTCTCTGCTGCCCCCCAGG - Intronic
1086406176 11:86500713-86500735 CTGGCCTTCTCATTCTTCCCAGG + Intronic
1087630777 11:100647994-100648016 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1087866162 11:103229002-103229024 CTGGCTTTCCCCCACTACCCTGG - Intronic
1088706026 11:112465482-112465504 CTTGCATTCTGCTGCTCCCAAGG - Intergenic
1088979791 11:114851865-114851887 CTGGCTTTTTCCAGCTCTGCAGG + Intergenic
1088994595 11:114985602-114985624 CGGGCTGTCTCCACCTCCCCAGG + Intergenic
1089053645 11:115566739-115566761 CTGGGTTTCTCTGACTCCCCAGG + Intergenic
1089491129 11:118885039-118885061 CTGACTCCCTCCTGCTCCCCCGG + Intronic
1089974689 11:122722312-122722334 CTGGTTCTCTCCTGCACTCCAGG + Intronic
1090067165 11:123512891-123512913 TTGGCTTTCATCAGCTCCCCAGG + Intergenic
1090406657 11:126479834-126479856 CTGGCGTTCTCCTGGACCACTGG + Intronic
1090769899 11:129910656-129910678 ATTGCTTTCTCTTTCTCCCCAGG - Exonic
1091015389 11:132046596-132046618 CAGGCTTTCACCTGTTCTCCTGG + Intronic
1091027958 11:132158945-132158967 CTGGCCCTCTCCTGCTATCCAGG - Intronic
1202820751 11_KI270721v1_random:68211-68233 CTGGCCTTCTCCTGGCCCCACGG + Intergenic
1092076263 12:5676065-5676087 CTGGGTTTCTGCTCCTCACCAGG + Intronic
1092233762 12:6792806-6792828 CTGGCTCTCCCGGGCTCCCCTGG - Intronic
1092254329 12:6917918-6917940 CTGTCTTTCTGTGGCTCCCCAGG + Exonic
1092509910 12:9144045-9144067 CTGACTTTCTCATGGTACCCGGG - Intergenic
1093427537 12:19045383-19045405 CTGTCTTTCTCCATCTCCTCAGG + Intergenic
1093758584 12:22880511-22880533 CTGTTTTTCTCCTGCTCAGCTGG + Intergenic
1096220738 12:49827190-49827212 CACTCTTTCTACTGCTCCCCAGG + Intronic
1096519967 12:52179442-52179464 CTGCCTTCCTGCTGCTCCCAAGG + Intronic
1097747286 12:63315285-63315307 GTGGCTTTCTCATGCTGCCTGGG + Intergenic
1098841496 12:75483522-75483544 CTGTATTTCTCCTCCTTCCCTGG - Intronic
1099471334 12:83052941-83052963 CTGACTTTCTCCTACTCAACTGG + Intronic
1101302458 12:103495823-103495845 TTTGCTCTCTGCTGCTCCCCGGG - Exonic
1101348464 12:103906690-103906712 CTGGCTTGCTCCTCCTCCCTTGG + Intergenic
1101562156 12:105867129-105867151 CTGTCTTTCTCCCTCTCCTCAGG + Intergenic
1101741904 12:107507281-107507303 CTTGACTTCTCCTGCTTCCCTGG - Intronic
1101781797 12:107844366-107844388 CTGGCTGTCTCCTCCTCAGCGGG - Intergenic
1102269057 12:111515207-111515229 ATGTGTTTCTCCTGCTTCCCTGG - Intronic
1102505271 12:113380774-113380796 CTGGTCTTCTCCTCCTACCCCGG + Exonic
1102708214 12:114901458-114901480 CTGGCTTTCTGCCCCTCTCCCGG + Intergenic
1103478721 12:121237110-121237132 TTGGCTTAAACCTGCTCCCCAGG - Intergenic
1106416354 13:29549272-29549294 CTGGCTTCCTCCTGGTCCACGGG - Intronic
1107088182 13:36448223-36448245 CTGGCTTTCTCCTTTCACCCAGG + Intergenic
1107823178 13:44304702-44304724 CTGGCGTTCCCCAGCTCACCTGG + Intergenic
1108074106 13:46660972-46660994 CTGTTTTTCTCCAGCACCCCAGG + Intronic
1108134201 13:47338152-47338174 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1108642556 13:52396100-52396122 TTGGCTTTCTCCTCCGCCACTGG - Intronic
1110158074 13:72342448-72342470 CCGGCTTTCTCCCACTTCCCTGG - Intergenic
1110375999 13:74794418-74794440 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1110504719 13:76272146-76272168 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1113574980 13:111389037-111389059 CTGGCATCCTGCTGCTCCCAGGG - Intergenic
1113898811 13:113784383-113784405 CTGGCTTTCTCATGGTACCCAGG - Intronic
1114336945 14:21699941-21699963 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1114792219 14:25672373-25672395 CTGGCTTGCCCCTGAGCCCCGGG + Intergenic
1115136300 14:30112759-30112781 CTGACTTTCTCCCTCTCCTCAGG + Intronic
1115985759 14:39102814-39102836 CCGGCCTCCTCCAGCTCCCCTGG - Intronic
1116025463 14:39508789-39508811 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1117105509 14:52394018-52394040 CTGACTTTCGCATGTTCCCCGGG - Intergenic
1117271285 14:54146393-54146415 CTGGCTTTCCCCGACTTCCCTGG + Intergenic
1118075103 14:62289526-62289548 TTGGTTGTCTCCTGCTGCCCTGG + Intergenic
1119582708 14:75801294-75801316 CTGGCTTTCCCCTACTTCCCTGG - Intronic
1119931514 14:78551986-78552008 CTGGCTTTCAAATGCTGCCCAGG - Intronic
1119980814 14:79079043-79079065 CCTGCTTTCTCCAGCTCCTCAGG + Intronic
1120450937 14:84666004-84666026 CCAGCTTTCCCCTGCTTCCCTGG - Intergenic
1120605457 14:86570669-86570691 CTGGCTTTTCCCTACTTCCCTGG - Intergenic
1121218936 14:92271384-92271406 ATGGCTTCATCTTGCTCCCCAGG + Intergenic
1121486901 14:94323295-94323317 CTGGCTTGGTCCTGCTGTCCTGG + Exonic
1122403350 14:101480787-101480809 TTTGCTTTCTCTTCCTCCCCGGG + Intergenic
1122647591 14:103205750-103205772 CTGGCTTTGCCCGGCTTCCCAGG + Intergenic
1122659718 14:103287247-103287269 CTGCCTGCCTCATGCTCCCCAGG - Intergenic
1123047369 14:105525653-105525675 CGGGCATTCTCCTGCACCCTGGG + Intergenic
1123193895 14:106598090-106598112 CTCTCTCTCTCCTGCTGCCCTGG + Intergenic
1123499248 15:20865769-20865791 CAGGCTTTCTCTTCCTCCGCAGG - Intronic
1123556483 15:21439388-21439410 CAGGCTTTCTCTTCCTCCGCAGG - Intronic
1123592724 15:21876734-21876756 CAGGCTTTCTCTTCCTCCGCAGG - Intergenic
1124156020 15:27225885-27225907 CTGGGCTCCTCCTCCTCCCCTGG - Intronic
1124575232 15:30902253-30902275 CTGGCTCTCTGCTGCCTCCCTGG + Intergenic
1124639264 15:31385709-31385731 CTGTCTTTCTCCCTCTCCTCAGG + Intronic
1124857972 15:33409450-33409472 CTGGCTGTCTTGGGCTCCCCAGG + Intronic
1125153489 15:36561006-36561028 CATGCTCTCTCCTGCTGCCCTGG + Intergenic
1125723325 15:41855553-41855575 CTGGGTTCTTCCTGCTCTCCAGG + Exonic
1126067571 15:44837749-44837771 CTGCCTTTCTTCTCCTCCCAGGG - Intergenic
1126092307 15:45063133-45063155 CTGCCTTTCTTCTCCTCCCAGGG + Intronic
1126190233 15:45871345-45871367 CTGGCTTTCTCCCACTTCCCTGG + Intergenic
1127370654 15:58335974-58335996 CTGTCTTTCTCCATCTCCTCAGG + Intronic
1128375872 15:67075427-67075449 CTCCCCCTCTCCTGCTCCCCAGG - Intronic
1129184990 15:73900493-73900515 CCTGCTTTCTCCTTCTCCCCTGG + Intergenic
1129703056 15:77778990-77779012 CTGGCCTCCTCCTTCTCCCCTGG + Intronic
1129893128 15:79085037-79085059 CTGCCTGCCTCCTGCTCTCCTGG + Intronic
1131215949 15:90535284-90535306 CTGGCTTTCTCCTGCCCCTCTGG - Intronic
1131431693 15:92393684-92393706 CTGGCTTTATTCAGCTCCCGAGG - Intergenic
1131711339 15:95059594-95059616 CTGGCTTTCTCCCATTTCCCTGG - Intergenic
1131891743 15:96979392-96979414 CTAGCTTTCTCCAGCACCCTGGG + Intergenic
1202964825 15_KI270727v1_random:166577-166599 CAGGCTTTCTCTTCCTCCGCAGG - Intergenic
1132619245 16:856564-856586 CTTGCTTTCTGCTCCTTCCCAGG + Intronic
1132994976 16:2818090-2818112 CTGGTGTTCTCCTGAGCCCCAGG + Intronic
1133021255 16:2967907-2967929 GTGGCCTTGCCCTGCTCCCCCGG + Exonic
1133281870 16:4671241-4671263 CTGCCCTTCTCCTGGCCCCCAGG + Intronic
1134556805 16:15172672-15172694 CTGGCCAGCGCCTGCTCCCCAGG + Intergenic
1134917385 16:18084390-18084412 CTGGCCAGCACCTGCTCCCCAGG + Intergenic
1135486541 16:22870615-22870637 CTGGCTTCCTCCCTGTCCCCCGG + Intronic
1137223254 16:46476988-46477010 TCGGCTATCTCCTTCTCCCCAGG - Intergenic
1138393418 16:56686337-56686359 ATGTTTTTCTCCTGCTCCCCTGG - Intronic
1138507561 16:57485919-57485941 CTGCCTTCCTGCTCCTCCCCGGG - Intronic
1139431186 16:66911846-66911868 CTGGATTGCCCCTGCTCCCTGGG - Intronic
1140664015 16:77212507-77212529 GTGGCTTCCTCCTCGTCCCCTGG + Intronic
1141673035 16:85502846-85502868 CCTGCTTGCTCCTGGTCCCCAGG - Intergenic
1141712453 16:85707966-85707988 CTGGCTGGCTCCTGCTCCAGCGG - Exonic
1141798091 16:86287928-86287950 CCTGCCTTCTCTTGCTCCCCAGG - Intergenic
1141964428 16:87432415-87432437 CTTTCTTCCTCCTGCTGCCCAGG + Intronic
1141982619 16:87559882-87559904 CAGGGTTGATCCTGCTCCCCAGG + Intergenic
1142563201 17:823495-823517 CTGGCCTTCTCCTGTGCCCGAGG - Intronic
1143780847 17:9228519-9228541 CTGGCTTCTTCCTACTCCCTGGG + Intronic
1144278373 17:13699282-13699304 CTGGCTTTCCCCTACTTCCCTGG - Intergenic
1144725908 17:17502739-17502761 CAGGATCTCTCCAGCTCCCCTGG + Intergenic
1144853296 17:18254802-18254824 TTGGCGTTCTCCAGCTCCCGCGG + Exonic
1145256178 17:21323689-21323711 CTGGCTTTCTCAAACTGCCCTGG - Intergenic
1145320435 17:21764262-21764284 CTGGCTTTCTCAAACTGCCCCGG + Intergenic
1146063312 17:29618157-29618179 CGGGCTTGCTCCTGCTCGCCGGG + Intronic
1146123889 17:30217304-30217326 CTTTCTTTCTCCTTCACCCCAGG - Exonic
1146409645 17:32571383-32571405 CTGCCTTTCTTCTGCTCCCCTGG + Intronic
1147590851 17:41682547-41682569 CTGGCCTTCTCCACCTCCCTAGG + Intergenic
1147632529 17:41941319-41941341 CTGGCTTTCTCCAGGCCCCCAGG + Intronic
1147951946 17:44112358-44112380 CTGGCCTGCCCCTGCTCCTCAGG + Intronic
1148340077 17:46868057-46868079 CTGTCTGTCTCAGGCTCCCCAGG - Intronic
1148400632 17:47356994-47357016 CTGGCTTTCCCCCACTTCCCTGG - Intronic
1150014273 17:61538051-61538073 CTGTCTCTCTCCTTCTCCTCAGG + Intergenic
1150528636 17:65953680-65953702 CTGGCTTTCCCCTACTTCCCTGG + Intronic
1151347314 17:73510053-73510075 CGGGCCTTCTCCTGCACCCCAGG + Intronic
1151641064 17:75394322-75394344 TTTACTTTCTCCTGCTCTCCTGG - Intronic
1151971151 17:77458108-77458130 CTGGTATTTTCCTGCTCGCCAGG + Intronic
1152041511 17:77906682-77906704 CTGCCTGTGGCCTGCTCCCCAGG + Intergenic
1152045101 17:77930273-77930295 CCGGCTCCCTCCTGCTGCCCTGG - Intergenic
1152145155 17:78564024-78564046 CAGGCTTTCCCCTGCATCCCTGG - Intronic
1153343751 18:4004378-4004400 CTGCCTTCCTCCTGCTCTCCGGG + Intronic
1153741977 18:8138660-8138682 GTGGCTTTCTGCTGTTCCTCTGG + Intronic
1153972469 18:10238985-10239007 CTGCCTGCCTCCTGCTGCCCGGG - Intergenic
1154457291 18:14542523-14542545 CAGGCTTTCTCTTCCTCCGCAGG - Intronic
1155438181 18:25834349-25834371 ATGGCTTTGCTCTGCTCCCCCGG + Intergenic
1155573841 18:27223975-27223997 CTGGCTTTCTCCCACTTCCTTGG - Intergenic
1157211868 18:45749756-45749778 GTGGCTTTCTCTTCTTCCCCAGG + Exonic
1157508801 18:48252766-48252788 CTGGCTTCCTCCTCCACCCATGG + Intronic
1157546414 18:48549765-48549787 CTTGCTTTCTCCTCCTCCACTGG - Intronic
1157894095 18:51447731-51447753 CTGGCTTTCTCTGGCTCCTGGGG + Intergenic
1160137203 18:76282531-76282553 CTGCCTCTTTCCTGCTCCTCTGG + Intergenic
1161088515 19:2345837-2345859 CTGTCTTTCTCATTCTCCCTGGG + Intronic
1161209727 19:3060145-3060167 CTGACTTTCTCCAGATTCCCAGG + Intronic
1162341669 19:10094938-10094960 CTGACTTTCTCCGTCACCCCAGG - Exonic
1162738981 19:12763221-12763243 CTGGCTTCCTCCAGCTCACATGG - Exonic
1162804700 19:13131307-13131329 CTGGCTTTGTCCTCCTCCCTGGG + Intronic
1164120866 19:22263469-22263491 CTGACCTACTCCTGCTTCCCTGG - Intergenic
1164124951 19:22304825-22304847 CTGGCTTTCTCCTTGACCTCTGG - Intronic
1164175276 19:22768241-22768263 CTGGCTTTCTCCTGGACCTCTGG + Intronic
1164616767 19:29671782-29671804 CTGGCTTTCTACTGGTGGCCAGG + Intronic
1164950249 19:32330978-32331000 CTCTCTTCCTCCTGCTCCCATGG - Intergenic
1165099863 19:33432586-33432608 GAGGCTTCCTCCTGCTCCCAGGG - Intronic
1166318417 19:42001963-42001985 TTGGGTTTCTCTTTCTCCCCAGG - Intronic
1167420382 19:49399244-49399266 CTGGCTTTCTCCCTCTCTCCAGG + Intronic
1167669826 19:50844321-50844343 CTGGCTTTCTCCCACTTCCCTGG - Intergenic
1167981718 19:53281654-53281676 CTGGATTCCTCCTGCTCTGCTGG - Intergenic
1167984374 19:53302008-53302030 CTGGATTCCTCCTGCTCTGCTGG + Intergenic
1168677121 19:58286601-58286623 CTGGCTTTCTCCTGGTAGTCTGG - Exonic
925160342 2:1678870-1678892 CTGGGCCTCTCTTGCTCCCCAGG + Intronic
925652345 2:6104428-6104450 CTGGCTTTCCTCTACTTCCCTGG - Intergenic
925795687 2:7539782-7539804 CTGGCTTTCTCCCACTTCTCTGG - Intergenic
925837738 2:7962425-7962447 CTGTACTTCACCTGCTCCCCAGG + Intergenic
926171079 2:10552977-10552999 CTGTCTGTCTCCGGCCCCCCTGG - Intergenic
927176838 2:20415776-20415798 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
927342092 2:21993888-21993910 CTGGTTTTCTTCTGATCCCCAGG + Intergenic
927858587 2:26543246-26543268 CTGGCTTTTTCCTGCACGCAGGG - Intronic
927942410 2:27113235-27113257 CTGGCATTCTCCTGGTCAACTGG - Intronic
929047309 2:37802578-37802600 CAGCCTCTCTCCTGCTCCCCTGG + Intergenic
929053370 2:37856360-37856382 CTGTTTTTGTCCTGCTCCCTTGG - Intergenic
929665469 2:43830679-43830701 CGGGAGTTCTCCTGCTCCCAGGG + Intronic
932316919 2:70790662-70790684 CGGGCTTTCACCTGCGCACCCGG + Intergenic
933164983 2:79065813-79065835 CTGTCTTACTCCTGCTCCCACGG + Intergenic
934025156 2:87996362-87996384 CTGGCTTTCACCTTCCTCCCAGG - Intergenic
934111435 2:88747218-88747240 CCGGCTTTCTCCTACTTCCCTGG - Intronic
934861214 2:97764855-97764877 CTGGCTGTCACCTGCTCTCCCGG + Intronic
935145398 2:100391952-100391974 CTGGCTCCCTCCTCCACCCCGGG + Exonic
935744538 2:106179074-106179096 CTGGCTCTCTCCTCCTCCTGAGG + Intronic
936667241 2:114610627-114610649 CTGGCTTTGTCTTGGTGCCCTGG - Intronic
936701037 2:115012008-115012030 CTGGCTTTCCCCTACTTCCCTGG + Intronic
937066083 2:119019049-119019071 CTGTCGCTCTCCAGCTCCCCCGG - Intergenic
937918672 2:127114650-127114672 CTGGCTTACACCTGCTACCTAGG - Intergenic
938139898 2:128786999-128787021 CTGCCTCCCTCCTGCTCTCCCGG + Intergenic
938174869 2:129116426-129116448 CTGACTTTCTCCTTCTATCCTGG - Intergenic
939149450 2:138456012-138456034 CTAGCTTTCCCCTACTTCCCTGG + Intergenic
939402084 2:141707797-141707819 CAGGCTGTCTCCTGCTCCCACGG - Intronic
939869550 2:147511630-147511652 CTGCCTTCCTCCTCCTCCCAGGG + Intergenic
940322410 2:152390765-152390787 CAGCCTTTCTCCTGATGCCCTGG - Intronic
942678854 2:178455558-178455580 CAGCCTTTCTCCTGATGCCCTGG - Intronic
942747789 2:179255107-179255129 CTGTCTCTCTCCTTCTCCTCAGG + Intronic
944610561 2:201401349-201401371 TTGACTATCTCCTCCTCCCCTGG + Intronic
944613911 2:201440469-201440491 CTGGCTTTCTCCTCCTCCTTTGG + Intronic
944861526 2:203819791-203819813 CTTGCTTGCTCCTCCTCCACGGG - Intergenic
945449171 2:209973987-209974009 GTGGCTTTCCATTGCTCCCCGGG - Intronic
946172238 2:217902424-217902446 TTGTCTTTCTCCAGCTCCCTGGG - Intronic
946392656 2:219425927-219425949 CTGGGCTTCTCTTCCTCCCCAGG + Exonic
946396377 2:219445628-219445650 CCTGCTCTCTCCTGCTCTCCCGG - Intronic
947617452 2:231567601-231567623 CTGGCCTTCCCCCACTCCCCTGG + Intergenic
947860914 2:233356450-233356472 GTTGCTTTCTCCTGTTGCCCAGG + Intronic
948445727 2:238031287-238031309 CTGGCAGACTCCTGCTCCCCTGG + Intronic
1168768208 20:396533-396555 CAGGCATCCTCCTGCACCCCTGG + Exonic
1169243582 20:4006712-4006734 CAGGCTTTCTCCAACTCCCTGGG + Intronic
1170865288 20:20150101-20150123 CTGGCTTTCCCCCACTTCCCTGG + Intronic
1171038691 20:21739700-21739722 CTGGCTTTCTCCCACTTCCCTGG - Intergenic
1171142605 20:22755918-22755940 CTGGCTTTACCCTGATCCCTGGG + Intergenic
1172426639 20:34860179-34860201 GTGGCCTTCTCCTACTTCCCTGG - Intronic
1172593270 20:36132281-36132303 CTGGCCTTTTCCAGCTCTCCAGG + Intronic
1173619526 20:44426118-44426140 CTGGTTTTCTCCTACCCCTCTGG - Intronic
1173644897 20:44627105-44627127 CTGCGTCTCTCCCGCTCCCCTGG + Intronic
1175289757 20:57867932-57867954 ATGGCTTTTTCCTGAGCCCCAGG + Intergenic
1175384171 20:58583700-58583722 CCGCCCTGCTCCTGCTCCCCTGG - Intergenic
1175418337 20:58816172-58816194 CTGGCCTTCCCCAGCGCCCCTGG + Intergenic
1175569196 20:60006302-60006324 CTGGCAGTCTCCTGCTCATCTGG - Intronic
1176121679 20:63456906-63456928 CTGGCTTTCTGCTCATCCCCGGG - Intronic
1176816868 21:13610830-13610852 CAGGCTTTCTCTTCCTCCGCAGG + Intronic
1177158390 21:17521753-17521775 CTGGCTTCTACCTTCTCCCCTGG - Intronic
1178148650 21:29768684-29768706 CTGCCTCTCTCTTCCTCCCCGGG - Intronic
1178519434 21:33275787-33275809 CTGCCTCTCTCCTTCTCCTCGGG - Intronic
1178732845 21:35120632-35120654 CTGGCTTTCCCCCACTTCCCTGG + Intronic
1178831954 21:36063587-36063609 CTGGCTTTCTCGCGGTACCCGGG + Intronic
1179179677 21:39034855-39034877 CCGGCTTTCCCCATCTCCCCCGG - Intergenic
1179226052 21:39454496-39454518 CGCGCCCTCTCCTGCTCCCCAGG - Intronic
1179358718 21:40685493-40685515 CAGGAGCTCTCCTGCTCCCCTGG + Intronic
1179467867 21:41589699-41589721 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1179494712 21:41764272-41764294 CTGGCTCCCTGCAGCTCCCCTGG - Intronic
1179525632 21:41974237-41974259 CTGGCTTTCTTCTGTGCCACAGG - Intergenic
1179640693 21:42745657-42745679 CTGGCTGTCCCTTGCGCCCCAGG + Intronic
1179710511 21:43210555-43210577 CTGCCTTGCTCCTGTTCCTCAGG - Intergenic
1180732150 22:17990131-17990153 CTAGCTCACTCCTGATCCCCTGG - Intronic
1181373831 22:22440505-22440527 CTGGCTTTCTCCACCCCACCTGG + Intergenic
1181437398 22:22918710-22918732 CTGGGTCCCTCCTCCTCCCCCGG + Intergenic
1181516837 22:23419126-23419148 CTAGCTCACTCCTGATCCCCTGG - Intergenic
1181695050 22:24588738-24588760 CTGGCTTGTTCCTACTCCCTGGG - Intronic
1181803361 22:25361107-25361129 CTGGGTCTCTGCTGCACCCCAGG + Exonic
1182077307 22:27503917-27503939 CTAGCTTTCTCATCCTCTCCTGG + Intergenic
1183337802 22:37260613-37260635 CTGCCTTTCTCCTGGAGCCCTGG + Intergenic
1184047340 22:41979655-41979677 ATGGCTCTCTCTTGCTTCCCAGG - Intronic
1184074046 22:42164890-42164912 CTGGCTGCCTCCAGCTCCTCAGG - Intronic
1184606019 22:45575338-45575360 CTGGCCATGTCCTGCTCCACTGG - Intronic
1184656954 22:45946698-45946720 CTGGCTTTGCCCTGGGCCCCTGG - Intronic
1185141048 22:49101456-49101478 CAGGCTGTCTTCTCCTCCCCAGG + Intergenic
1185274358 22:49943944-49943966 CTGGCTGGGTGCTGCTCCCCGGG - Intergenic
1185380173 22:50504331-50504353 CAGCCTTACCCCTGCTCCCCAGG + Exonic
949377350 3:3405215-3405237 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
949511927 3:4773723-4773745 CTGCCTTGCTCCAGCTCCTCAGG - Intronic
949929987 3:9071077-9071099 CTGTTTGCCTCCTGCTCCCCTGG - Intronic
950162771 3:10772473-10772495 CGAGCTGTCCCCTGCTCCCCTGG - Intergenic
950549321 3:13656603-13656625 CCGGCTGTCTCCTTCTTCCCAGG + Intergenic
950634997 3:14308180-14308202 TTGGCTGGCTCCTCCTCCCCCGG + Intergenic
950686493 3:14622088-14622110 CTGGCGTCCTCCTGCTGCCCCGG + Intergenic
951078450 3:18424831-18424853 CTGGCTTTCGGCTGGGCCCCCGG + Intronic
951220558 3:20064908-20064930 CTGTCTTTCTCCTGTTCCTCTGG + Intronic
951325844 3:21301200-21301222 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
951691040 3:25396801-25396823 CTGGTTTTCTTCTACTTCCCTGG - Intronic
951727311 3:25774558-25774580 CTGGCTTTCCCCCACTTCCCTGG - Intronic
952522434 3:34174809-34174831 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
952590273 3:34944496-34944518 CTGTATTTCTCCTTCTCCTCTGG + Intergenic
953357970 3:42270529-42270551 CTCCCTTACTCCTGCTCCCTTGG - Intergenic
953567102 3:44042135-44042157 CTGGCATTCTCCTGGCCCCATGG - Intergenic
954073699 3:48161205-48161227 CTGGCTTTCTGTTGTTCCACTGG - Intronic
954107896 3:48419156-48419178 CTGCCCTCCTCCTGCTCCCCAGG + Intronic
954643850 3:52118653-52118675 CTGGCTTTCGACTGCTACGCTGG + Intronic
954710887 3:52504580-52504602 CTGGCCCTCACCTCCTCCCCTGG + Intronic
954789417 3:53120497-53120519 CTGGCTCTCTCCTCTTCGCCAGG + Intronic
954803655 3:53202475-53202497 CTGCCTTTGCCCAGCTCCCCGGG - Intergenic
955738196 3:62061932-62061954 CTGGCTTTCTCTTGATGCCAAGG + Intronic
956995709 3:74824612-74824634 CTGGCTTTCTCCCACTTTCCAGG - Intergenic
957501731 3:81066640-81066662 CTGGCTTTCTCCTGCTACCCAGG + Intergenic
959009760 3:101061371-101061393 CTGGCTTTCCCCCACTCTCCTGG - Intergenic
959361729 3:105402611-105402633 CTGGCTTTCTCCCACTTCCTTGG + Intronic
959867924 3:111292401-111292423 CCGGCTTTCCCCTACTTCCCTGG - Intergenic
960161302 3:114352816-114352838 CTGGCTTACTCCTGCTATCCTGG - Intronic
960387337 3:117035986-117036008 CTGCCTCTCTGCTCCTCCCCTGG - Intronic
960557133 3:119042493-119042515 CTGGCTTTCCCCCACTTCCCTGG + Intronic
961050713 3:123743932-123743954 CTAGCTTTCTCCTGCTATCCTGG - Intronic
961381793 3:126500264-126500286 CTGGACTGCTCCTGCTCCTCGGG + Intronic
961475358 3:127142567-127142589 CTGGCTTCCTCCTCCCTCCCCGG - Intergenic
962147442 3:132855361-132855383 CTGGCTTTCCCCTACTTCCCTGG - Intergenic
962191832 3:133319075-133319097 CTGGCTTTCCCCCACTTCCCTGG + Intronic
962271110 3:133978708-133978730 CTGGCTTCCATCTTCTCCCCAGG - Intronic
962320844 3:134389161-134389183 CTGGGTTTCAGATGCTCCCCAGG - Intergenic
962610667 3:137073507-137073529 CTGGCTGTCCCCTACTGCCCTGG - Intergenic
962928039 3:140012999-140013021 CTGGCTCCCTCCTGCTGCCTGGG - Intronic
963373898 3:144438190-144438212 CAGGCTTTCCCCTACTTCCCTGG - Intergenic
963604078 3:147399203-147399225 CTGGCTTTCACTTTCTCCCATGG + Intronic
964248651 3:154684495-154684517 CTGGCTTTCCCCTACTTCCCTGG - Intergenic
964985501 3:162732879-162732901 CTGGCTTTCCCCTACTTCCCTGG - Intergenic
965132847 3:164723637-164723659 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
966423991 3:179761378-179761400 CTGGCTTTCTCCTCCACTGCAGG - Intronic
966643137 3:182212703-182212725 CTGGCTCTCTCTCGCTCTCCTGG + Intergenic
966816396 3:183893298-183893320 CAGGCTGTCTCCTGCTCTCTGGG + Intergenic
968446667 4:655571-655593 CTGCCTTCTTCCTCCTCCCCAGG - Intronic
968854528 4:3109741-3109763 CTGTCCTCCTCCTCCTCCCCAGG - Intronic
969168445 4:5338778-5338800 CTGGATATCTCCTTTTCCCCAGG - Intronic
971431809 4:26576419-26576441 CTGTCATTCCCCTTCTCCCCAGG + Intronic
971576371 4:28280372-28280394 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
975243811 4:72094591-72094613 CCGGCTTTCCCCTACTTCCCTGG - Intronic
976367853 4:84250020-84250042 CTGGTTTACTCCTGTTACCCAGG - Intergenic
977905677 4:102475410-102475432 CTGGCTTTCCTCTACTTCCCTGG + Intergenic
978392458 4:108241609-108241631 CTGCCTTCTTCCTGCTCACCTGG + Intergenic
978491426 4:109315527-109315549 CTGGCTTCCTCATGCTGCCTGGG - Intergenic
979030184 4:115633562-115633584 CTGGCTTTCCCCCACTTCCCAGG - Intergenic
979584864 4:122403941-122403963 CTGGCTTTCCCCAACTTCCCTGG - Intronic
980519309 4:133910213-133910235 CTGGCTTTCCCTCACTCCCCTGG - Intergenic
980861074 4:138500150-138500172 CTGGCTTTCCCCAACTTCCCTGG - Intergenic
981442564 4:144799540-144799562 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
981681733 4:147407419-147407441 GTGGCTTCCTGCTGCTCCCTTGG + Intergenic
983239495 4:165215864-165215886 CTGGCTTTCTCCTATACTCCTGG + Intronic
983277428 4:165635592-165635614 CTGGCTTTCCCCAACTTCCCTGG + Intergenic
984704868 4:182840291-182840313 CAGGATTTCTCAGGCTCCCCAGG - Intergenic
985003864 4:185513212-185513234 ACGCCTTTCTCCTGCTCCTCTGG + Intronic
985038965 4:185869441-185869463 CTGTCTTTATGCTGCTACCCTGG + Intronic
985108342 4:186520945-186520967 CTGGCTTTCCCCAACTTCCCTGG - Intronic
985173200 4:187174179-187174201 CTGGTCTTCTCCTGCTCCTCCGG + Intergenic
985354255 4:189100447-189100469 CCGGCTTTCTCCAGCGCCCGGGG + Intergenic
985749175 5:1664236-1664258 GAGGCTGTCTCCTGCTCACCAGG - Intergenic
986251242 5:6060322-6060344 ATGCCTTCCACCTGCTCCCCAGG - Intergenic
986457162 5:7931234-7931256 CTGAGCATCTCCTGCTCCCCTGG - Intergenic
986558987 5:9041706-9041728 CTGAGCATCTCCTGCTCCCCTGG + Exonic
986802456 5:11276403-11276425 CTGGTTTCCTCCTACTTCCCAGG + Intronic
986802747 5:11278835-11278857 CTGGTTTCCTCCTACTTCCCAGG + Intronic
987051369 5:14149147-14149169 CTGGCTTCCTGCTGGACCCCTGG + Intronic
987128720 5:14840746-14840768 CTGGCTTTCTAATGATGCCCAGG + Intronic
987249209 5:16081208-16081230 CTGGCTGTCTCCTCTTCCTCAGG + Intronic
987391456 5:17379922-17379944 GGGGCTTTCTCCTGTTTCCCTGG + Intergenic
987440626 5:17951794-17951816 CCAGCTTTCCCCTGCTTCCCTGG - Intergenic
987750418 5:22031707-22031729 CTGTCTCTCTCCTTCTCCTCTGG - Intronic
988725211 5:33919945-33919967 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
989562815 5:42870993-42871015 CTGGCCTTCCCCTACTTCCCTGG - Intronic
990540455 5:56767355-56767377 CTGGCATTCTCCTCTTGCCCAGG + Intergenic
991524179 5:67538007-67538029 CTGCCTTTCTCCTGCTGACTCGG - Intergenic
994208251 5:97059878-97059900 CTGGCTATCCCCTACTTCCCTGG - Intergenic
996025272 5:118638624-118638646 CTGACTTTCCCCTACTTCCCTGG + Intergenic
996310609 5:122099659-122099681 CTGGCTCCTTCCTTCTCCCCTGG - Intergenic
996391508 5:122967520-122967542 CTGGCTGCTTTCTGCTCCCCAGG - Intronic
996775344 5:127126944-127126966 CTAGCTTTGTCTTGCTCCTCTGG + Intergenic
996958812 5:129218798-129218820 CTTGCCATCTCCTGCTCACCAGG - Intergenic
997724250 5:136106910-136106932 CTGGCTCTCACCTGCTGCCCAGG - Intergenic
998386308 5:141758964-141758986 CTGGCTCCCTCCTCCTCTCCGGG - Intergenic
999337492 5:150734862-150734884 CTGGCTTTCCCCTACTTCCCTGG + Intronic
999848813 5:155515336-155515358 TTTGCGTTCTCCTACTCCCCTGG - Intergenic
1000203007 5:159030500-159030522 GAGGCTTTCTCCAGCTCCTCTGG - Intronic
1000205019 5:159050535-159050557 CCTCCTTTCTCCAGCTCCCCTGG + Intronic
1000822031 5:165996711-165996733 CTGGGTTTCTCCGGATTCCCTGG - Intergenic
1001166604 5:169374436-169374458 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1001583691 5:172818300-172818322 CTGGCATCCCCCTCCTCCCCTGG - Intergenic
1001905576 5:175470042-175470064 CCAGCTTCCTCCTGCTCCCCTGG - Intergenic
1001930296 5:175668168-175668190 CTGCCTTCCTCCAGCTCCCCAGG - Intronic
1002197202 5:177508042-177508064 CTCACTTCCTCCTGCTCCCCTGG + Intronic
1002385887 5:178867029-178867051 CTGTCTTTCTCCACCTCCCAGGG - Exonic
1002859169 6:1064812-1064834 CAGGCTCTGTCCTGCTGCCCTGG - Intergenic
1003476892 6:6491736-6491758 CTGCCCTTCTCCTGGGCCCCAGG + Intergenic
1003490273 6:6615183-6615205 CTGGTTTTCAAATGCTCCCCAGG - Intronic
1003693975 6:8383769-8383791 TTGTCTTTCTTCTGGTCCCCTGG + Intergenic
1004976504 6:20973389-20973411 CTAGCTTTCTCCTTCCCCACAGG - Intronic
1006402982 6:33828620-33828642 CTGGCCTTCTCCTGCAAACCAGG + Intergenic
1006516627 6:34549196-34549218 CTGGCTCCCTCCTGCTCCAGAGG + Intronic
1006793280 6:36717251-36717273 CTGGCTGTCTTCCCCTCCCCAGG + Exonic
1007094557 6:39205307-39205329 GGGGCTCTTTCCTGCTCCCCAGG - Intronic
1007409564 6:41653979-41654001 CTGCCTCTCTCCTCCACCCCAGG + Exonic
1007498285 6:42276878-42276900 CGGGCTTCCTACTGATCCCCAGG - Intronic
1007864652 6:44955450-44955472 CTGGCTTTCCCCCACTTCCCTGG + Intronic
1009349925 6:62661519-62661541 CTGCCATTCTTCTGCTCCTCTGG + Intergenic
1009846488 6:69141612-69141634 TTGGCTTCCTACTGCTCTCCAGG - Intronic
1011375531 6:86682322-86682344 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1011512145 6:88113295-88113317 TTGTCTTTCTCCTGCACCCCAGG - Intergenic
1013078128 6:106789105-106789127 CTGACCTTCTCCTGCTCCGTTGG - Intergenic
1013495549 6:110693625-110693647 CTGGCTTTCCCCTACTTCCCTGG + Intronic
1013575918 6:111483359-111483381 GGGGCTTTCTCCCCCTCCCCGGG + Intronic
1013946598 6:115729163-115729185 CTGGCTTTCTCCCACTTCCCTGG - Intergenic
1014088131 6:117371789-117371811 CTGGCTTTTCCCCACTCCCCTGG + Intronic
1017219506 6:151949697-151949719 CCAGCTTTCTACTGCTCCCGTGG + Intronic
1018069797 6:160154299-160154321 CTGGCTTGACCCTGCTCCCAGGG + Intronic
1018168776 6:161127100-161127122 CCGGCTTTCCCCTGCTTCCTGGG - Intergenic
1018254890 6:161908218-161908240 CTGACTCTCACGTGCTCCCCAGG - Intronic
1018456692 6:163959886-163959908 CTAGCTTTCTCCTGTTTCCTTGG + Intergenic
1018969395 6:168515740-168515762 GTGTTTTGCTCCTGCTCCCCAGG - Intronic
1019313705 7:375046-375068 CTGGCTGTCTCCAGCTGCACAGG - Intergenic
1019672796 7:2291272-2291294 CAGGGTGTCTTCTGCTCCCCAGG - Intronic
1019724803 7:2595608-2595630 CTGGCTCTCTGCTGCCTCCCTGG + Intronic
1019914396 7:4123479-4123501 CCGGCTCACTCCTGCTCCCTGGG - Intronic
1020055887 7:5117386-5117408 CCGGCTTCCTCCTGCCCTCCAGG + Intergenic
1020349387 7:7201591-7201613 CCGGCTTTCCCCCGCTTCCCTGG - Intronic
1022415971 7:30177314-30177336 CTGGCTCTCTCCTGCTCCTCTGG - Intergenic
1023692522 7:42805949-42805971 CTGGCTTTCTTCCACTTCCCTGG + Intergenic
1024295529 7:47839034-47839056 CTGGCTATCTCCTGCCATCCTGG + Intronic
1024810672 7:53207677-53207699 CTTGCCTTCTCCTGCTCAACAGG - Intergenic
1025978132 7:66385768-66385790 CTCCCTCTCTCCTGCTCCACTGG + Intronic
1026509517 7:71016477-71016499 TTGAATTTCTCCTGCTCCCTGGG - Intergenic
1027444363 7:78255514-78255536 CTGGCTTCCACCTGCTAGCCTGG + Intronic
1027691704 7:81354670-81354692 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1027733337 7:81903202-81903224 CTGGCTTTCCCCAACTTCCCAGG - Intergenic
1028197106 7:87920139-87920161 CTGGCTATCCCCTACTTCCCTGG + Intergenic
1028197728 7:87926788-87926810 CTGGTTTTCCCCTACTTCCCCGG + Intergenic
1028782842 7:94757102-94757124 CTGGCTTTTTCTTACTTCCCTGG + Intergenic
1029124750 7:98288219-98288241 CTGGCTCCCTCCAGCTCCCCCGG + Intronic
1029479761 7:100805367-100805389 CTGGGTTCCACCTCCTCCCCCGG - Intronic
1031000347 7:116408544-116408566 CTGGCTTGCTGCTGCTCCCAAGG - Intronic
1031220449 7:118958361-118958383 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1031401540 7:121329976-121329998 CAGGCTCGCACCTGCTCCCCAGG - Intronic
1032121528 7:129160473-129160495 CTGGGGCTCTCCTGCACCCCTGG + Intronic
1032139127 7:129310489-129310511 CTGGCTTTCTCCTTCAACCCTGG - Intronic
1032683901 7:134211065-134211087 CTGGCTTCCTCCTGAACCCATGG + Intronic
1033274661 7:139962368-139962390 CTTGGCTTCTCCTGCTCTCCGGG + Intronic
1033329628 7:140407287-140407309 CTGCCATTCTCCTGCTCTCCGGG + Intronic
1033816742 7:145082895-145082917 CCGGCTTTCTCCCACTTCCCTGG - Intergenic
1034247902 7:149662895-149662917 CTGGCTTTCTACCACTTCCCTGG - Intergenic
1034266349 7:149782925-149782947 CTGCCTTTCTGCTGCTGCGCTGG + Intergenic
1035129549 7:156640007-156640029 CTGGCCTTTTCCTGCTCCCTAGG - Exonic
1036091033 8:5665472-5665494 CTGGATGTCTCCTGCTGCTCAGG - Intergenic
1036133566 8:6138755-6138777 CTGGCATTGCCCTGCTCCCTGGG + Intergenic
1037320830 8:17641041-17641063 CTGGCTTTCCCCCACTTCCCTGG - Intronic
1037857644 8:22383311-22383333 CTGGCTGCCTCCTCCTCTCCTGG - Intronic
1037875954 8:22548587-22548609 CTTCCTTTCTTCTCCTCCCCAGG - Intronic
1038262018 8:26003725-26003747 CTGGCTGTCACCTCTTCCCCAGG - Intronic
1038485337 8:27931188-27931210 CTGGTTTTCTCCTGCATCCCAGG - Intronic
1038647352 8:29372883-29372905 CTTCCCTTCTCCTCCTCCCCGGG - Intergenic
1038781261 8:30569964-30569986 CTGGCTTGCCCCTGCTCCGCCGG + Intronic
1038828387 8:31032609-31032631 CTGGATTTCGGCTGCGCCCCCGG + Exonic
1039001016 8:32980006-32980028 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1039030099 8:33299559-33299581 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1039144994 8:34437706-34437728 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1040422227 8:47251456-47251478 GTAGCTGTGTCCTGCTCCCCAGG - Intergenic
1041150320 8:54925834-54925856 CTGGCTTTCTCCTACTTCCCTGG + Intergenic
1041237957 8:55823778-55823800 CTTCCTTCCTCCTCCTCCCCAGG - Intronic
1041897111 8:62937925-62937947 CCGGCTTTCTCCCACTACCCTGG + Intronic
1041927095 8:63248352-63248374 CTGGCTTTCCCCAACTTCCCTGG - Intergenic
1042645549 8:70982454-70982476 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1043104424 8:76089945-76089967 CCGGCTTTCTCCCACTTCCCTGG - Intergenic
1044657174 8:94560975-94560997 CTGGTTTTCTCCCACTTCCCTGG - Intergenic
1045671036 8:104553465-104553487 CTGGCTTTCCCCCACTTCCCTGG + Intronic
1048456160 8:134580063-134580085 CTGGCGGCCTCCTGCTCTCCTGG - Intronic
1048986682 8:139738574-139738596 CTGGCATTCTCCAGCTCCTGGGG - Intronic
1049052672 8:140210908-140210930 CAGCCATTCTGCTGCTCCCCAGG + Intronic
1049805764 8:144538100-144538122 CTGCTCTCCTCCTGCTCCCCAGG - Intronic
1051177974 9:14380252-14380274 CTGGCTTTCCCTTGCTTCCATGG - Intronic
1052253469 9:26426875-26426897 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1053174261 9:35910757-35910779 CTGGCCTTCCCCTCCTCCCAGGG + Intergenic
1053609469 9:39697467-39697489 CTGGCTCCCTTCTGCTCTCCTGG + Intergenic
1053867365 9:42454052-42454074 CTGGCTCCCTTCTGCTCTCCTGG + Intergenic
1054088846 9:60774025-60774047 CTGGCTCCCTTCTGCTCTCCTGG - Intergenic
1054244055 9:62644930-62644952 CTGGCTCCCTTCTGCTCTCCTGG - Intergenic
1054558180 9:66679478-66679500 CTGGCTCCCTTCTGCTCTCCTGG - Intergenic
1056526218 9:87445416-87445438 CTGGATGTCACCTCCTCCCCAGG - Intergenic
1057312835 9:93952501-93952523 CTGGCAGTCTTATGCTCCCCAGG - Intronic
1057825944 9:98372090-98372112 CTGGCTCTCACCTATTCCCCAGG + Intronic
1058647348 9:107142781-107142803 CTGGCTTTGTCTTACTTCCCAGG + Intergenic
1059474286 9:114531757-114531779 CTGGCTTTCTCCAGGCCTCCAGG + Intergenic
1059673764 9:116516842-116516864 CTGGCTTTCCCCTACTTCCCTGG + Intronic
1060265439 9:122109162-122109184 CTGGCTTTGGCCTGGTCCCCAGG + Intergenic
1060414312 9:123419917-123419939 CTGGTCTTCTCCAGCTGCCCTGG - Intronic
1060556514 9:124510690-124510712 CTGGCTTTGTCCTAGTCTCCTGG + Intergenic
1060778994 9:126398052-126398074 CTGGCAGCCTCCTCCTCCCCTGG + Intronic
1061245248 9:129398300-129398322 CTGGCTTTCCTCTGGTCTCCAGG - Intergenic
1062099777 9:134722013-134722035 CTCGGTTTCTCCTTCTCCACGGG + Intronic
1062713557 9:137990184-137990206 CTGGCTTTCTCCCACTTTCCTGG + Intronic
1203530493 Un_GL000213v1:138664-138686 CAGGCTTTCTCTTCCTCCGCAGG - Intergenic
1185866622 X:3629963-3629985 CTGTCTTTTTCCTGGTCTCCAGG - Intronic
1186760428 X:12716950-12716972 CTGCCTTTCTCCTTGTCCTCGGG - Exonic
1186956826 X:14691655-14691677 CTGTATTTCTGCAGCTCCCCAGG + Intronic
1187311025 X:18142879-18142901 CTGTCTCTCTCCTTCTCCTCAGG + Intergenic
1188927768 X:36066861-36066883 CTGCTTTTCTCCTTCTCCCTGGG - Intronic
1190908473 X:54750779-54750801 CTGGTTTTCTCTAGCTCCCTGGG + Intronic
1191016918 X:55819015-55819037 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1191077314 X:56468954-56468976 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1191879294 X:65828533-65828555 CTGGCTTTCCCCTACTTCCCTGG + Intergenic
1192496297 X:71618366-71618388 CTGGCATTCCCCTGATGCCCCGG + Intronic
1192622551 X:72693664-72693686 CTGGAGTTCCCCTCCTCCCCAGG - Intronic
1192900017 X:75486709-75486731 CTGGCTTTCCCCCACTTCCCTGG + Intronic
1193590601 X:83384488-83384510 CTGGCTTTTTCCTACTTTCCTGG + Intergenic
1194095334 X:89632347-89632369 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1194278196 X:91913429-91913451 CTGGCTATCTCCCACTTCCCTGG + Intronic
1194532803 X:95071928-95071950 CTGGCTTTCCCCTACTCTTCTGG + Intergenic
1194602533 X:95940415-95940437 CCAGCTTTCTCCGGCTTCCCTGG + Intergenic
1195667428 X:107443716-107443738 CAGCCTTTCTACAGCTCCCCAGG + Intergenic
1195671135 X:107471022-107471044 CTAGCTTTCTCCTTATTCCCTGG - Intergenic
1197120060 X:122880560-122880582 CTGGCTTTCCCCCACTTCCCTGG + Intergenic
1198624990 X:138561026-138561048 TTGGCTTTTGCCTGCTCCACAGG + Intergenic
1198633517 X:138669662-138669684 CTGCCTCTCCCCTTCTCCCCTGG + Intronic
1199014979 X:142804531-142804553 CTGGCTTTTCCCTACTTCCCTGG - Intergenic
1199265524 X:145822067-145822089 CTGCCCATCTCCTCCTCCCCTGG - Exonic
1200232184 X:154449610-154449632 CTGGCTGTCTCCTCCCTCCCTGG + Intronic
1200447965 Y:3288525-3288547 CTGGCTTTCCCCCACTTCCCTGG - Intergenic
1200595533 Y:5135504-5135526 CTGGCTATCTCCCACTTCCCTGG + Intronic
1201452826 Y:14134874-14134896 CTGTCATTCTCCTTCTTCCCTGG - Intergenic
1202043703 Y:20714542-20714564 CTAGATTTCCCCTACTCCCCTGG + Intergenic