ID: 1081793715

View in Genome Browser
Species Human (GRCh38)
Location 11:45805586-45805608
Sequence CAACCTACTCCCACCCCGAG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 74}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081793715_1081793720 -5 Left 1081793715 11:45805586-45805608 CCCCTCGGGGTGGGAGTAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081793720 11:45805604-45805626 GGTTGTGGAGCAGCACAACTGGG 0: 1
1: 0
2: 0
3: 8
4: 115
1081793715_1081793724 29 Left 1081793715 11:45805586-45805608 CCCCTCGGGGTGGGAGTAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081793724 11:45805638-45805660 GCAGAACTTCTCAATCCATGAGG 0: 1
1: 0
2: 0
3: 8
4: 111
1081793715_1081793719 -6 Left 1081793715 11:45805586-45805608 CCCCTCGGGGTGGGAGTAGGTTG 0: 1
1: 0
2: 0
3: 5
4: 74
Right 1081793719 11:45805603-45805625 AGGTTGTGGAGCAGCACAACTGG 0: 1
1: 0
2: 1
3: 16
4: 142

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081793715 Original CRISPR CAACCTACTCCCACCCCGAG GGG (reversed) Exonic
901672434 1:10863602-10863624 GCACCCCCTCCCACCCCGAGGGG - Intergenic
904081445 1:27874940-27874962 CAACCTACTCAGCCCCTGAGAGG + Intronic
906640382 1:47437800-47437822 CCAACCACTGCCACCCCGAGGGG + Exonic
906728018 1:48058176-48058198 CAACCTCCCCCCACCCCAACAGG + Intergenic
907308004 1:53524287-53524309 CTTCCTGCTCCCACCCAGAGGGG + Intronic
917285210 1:173416003-173416025 CAACCTACTCCCTGCCCCATCGG - Intergenic
918070699 1:181131700-181131722 CACCCTCCTCCCACCCCGCCAGG + Intergenic
920080752 1:203371311-203371333 CCACCTACTCACACCCCTATGGG - Intergenic
1063959539 10:11295834-11295856 CAAACCCCTCCCACCCAGAGGGG + Intronic
1064244852 10:13660193-13660215 CAACCTAGTTCCTCCCCGTGGGG - Intronic
1070558773 10:77550231-77550253 CAGCCTACTCCCAAGCCCAGTGG + Intronic
1080887218 11:36377538-36377560 CAGCCTGGTCCCACCCCGGGCGG - Intronic
1081793715 11:45805586-45805608 CAACCTACTCCCACCCCGAGGGG - Exonic
1082782326 11:57297607-57297629 CACCCTCCTCCCACCCCTAAAGG + Intergenic
1084268858 11:68018698-68018720 CAGCCAGCTCCCACCCAGAGGGG - Intronic
1090918837 11:131190726-131190748 CAGCCCACTCCCACCCTCAGTGG - Intergenic
1096077491 12:48814601-48814623 CTACTTATTCCCACCCCGTGGGG - Intronic
1110869573 13:80434768-80434790 CCCCCTACCCCCACCCCGACAGG + Intergenic
1115635588 14:35287585-35287607 CCACCTACCTCCACCCCCAGGGG + Intronic
1121744186 14:96275203-96275225 CACCCTAATCCCACCCTGAGTGG + Exonic
1122050475 14:99056063-99056085 CAGGCTACTGCCACCCCGTGAGG - Intergenic
1122123677 14:99567985-99568007 CCCCCCACTCCCACCCCCAGAGG + Intronic
1132585100 16:702713-702735 CAACCTAGTCCCAACCCCAGAGG - Intronic
1136414511 16:30095434-30095456 CCACCTACTCCCTCCCCGGCAGG - Exonic
1136568824 16:31084922-31084944 GAGCCTACACCCACCCTGAGGGG - Exonic
1138458267 16:57133413-57133435 AGACCAACTCCCACCCCCAGGGG + Intronic
1140223017 16:73057959-73057981 CAACTTTGCCCCACCCCGAGAGG - Intronic
1145267714 17:21388434-21388456 CCACCTACACCCACCTCCAGAGG - Intronic
1146956437 17:36938781-36938803 CTACCTTTTCCGACCCCGAGCGG + Intronic
1149507246 17:57204469-57204491 CAGCCTACTCCCACAGCCAGAGG + Intergenic
1151914513 17:77107649-77107671 CAACCTCCTCACACACCGAGGGG + Intronic
1153302011 18:3599474-3599496 CATCCTACTCCCACCTTCAGAGG + Intronic
1155416597 18:25605660-25605682 AAACCTACCCCCAACCTGAGAGG + Intergenic
1155611192 18:27669455-27669477 CCACCTGCTCCCACCATGAGGGG - Intergenic
1158566901 18:58561720-58561742 CTACCAACTCCCACCCCCATTGG + Intronic
1160865306 19:1253507-1253529 CAACCCACACCCACCCTGAACGG + Intronic
1161756113 19:6135582-6135604 CACCCCACCCCCACCCCTAGGGG - Intronic
1166037251 19:40177859-40177881 CAACCTACACCCACCCCAGTAGG + Intergenic
1167259401 19:48450090-48450112 CCACCCACTCCCACCCCCTGTGG + Intronic
1167785269 19:51630529-51630551 CATTCTGCTCCCACCCCGACTGG + Intronic
926893364 2:17658142-17658164 CAACCTACCCCCAAACCTAGTGG + Intergenic
927955407 2:27204347-27204369 CAACCGTCTCCCACCCAGGGTGG + Intronic
929430314 2:41880716-41880738 CAACCTTCCCCCACCCTGAGTGG - Intergenic
931192653 2:60020585-60020607 GAGCCTCCTCCCTCCCCGAGGGG - Intergenic
941676508 2:168348274-168348296 CAGGCAACTCCCACCCTGAGTGG + Intergenic
943455631 2:188103431-188103453 GGACCCACTCCCACCCTGAGTGG + Intergenic
946276507 2:218635720-218635742 GACCCTACTCCCAACCCCAGGGG - Intronic
947841228 2:233209096-233209118 TACCCTGCACCCACCCCGAGAGG + Intergenic
1170869553 20:20192570-20192592 CAAGCTACTCCCACTCTAAGAGG - Intronic
1172760197 20:37316091-37316113 CAAGCTGCTCCCTCCCCGTGGGG + Intronic
1174583840 20:51592442-51592464 CAACCCACTCCCATGCCCAGTGG - Intergenic
1176383857 21:6127353-6127375 CTCCCCACCCCCACCCCGAGAGG - Intergenic
1179739616 21:43410885-43410907 CTCCCCACCCCCACCCCGAGAGG + Intergenic
1181457237 22:23066747-23066769 CAACCACCCCCCACCCCCAGCGG - Intronic
953496748 3:43393996-43394018 CAGCCTTTTCCCACCCCCAGGGG - Intronic
956790352 3:72675369-72675391 CAACCTCCTCCCACACTGAATGG + Intergenic
959523613 3:107349685-107349707 CAAAGTACTCCCACCCATAGAGG + Intergenic
966868523 3:184275955-184275977 CACCCTCCCCCCACCCCGGGCGG + Intronic
968771729 4:2511804-2511826 CACCCTCCTCCCACCCACAGAGG - Intronic
976082933 4:81375952-81375974 CAACCCACACCCACCCACAGAGG - Intergenic
984739077 4:183141502-183141524 CACCCTACTACCACCCCAGGAGG + Intronic
989328188 5:40224666-40224688 AAACTTCCTCCCATCCCGAGAGG + Intergenic
995042701 5:107607271-107607293 GATCCTTCTCCCACCCCGGGTGG + Intronic
999723946 5:154419436-154419458 CCACATAGTCCCACCCCAAGTGG + Exonic
1005345637 6:24887236-24887258 CAAGCTACACCCACCGTGAGAGG + Intronic
1015163280 6:130176530-130176552 CACCCTTCTCCCTCCCAGAGTGG - Intronic
1020975509 7:15001158-15001180 CAACCGACTTCCACCATGAGGGG + Intergenic
1024107646 7:46108998-46109020 CAACAGAGTCCCATCCCGAGAGG + Intergenic
1030191713 7:106817191-106817213 CTCCCTACCCCCACCCCCAGTGG + Intergenic
1032613312 7:133440074-133440096 CAACCCTCTCCCACCCCCACAGG + Intronic
1034518320 7:151599553-151599575 CCACCCACTACCACCCCCAGTGG - Intronic
1035366323 7:158351202-158351224 CCACCTCCACCCACCCCCAGGGG + Intronic
1049197907 8:141325568-141325590 CAACCAACCCCCACCACGAGGGG + Intergenic
1058876541 9:109249789-109249811 CAACCTCCTCCCACCCTCCGGGG + Intronic
1060874890 9:127075643-127075665 CAGCCTCCTCTCACCCCAAGGGG - Intronic
1062560021 9:137137373-137137395 CCACCCACCCCCACCCCGTGGGG - Intergenic
1185985249 X:4825454-4825476 AAAAATACTCCCACCCCCAGTGG - Intergenic
1187319449 X:18226831-18226853 CAAACTCCTGCCACCCCGGGGGG + Intergenic
1188402525 X:29764429-29764451 CAACCTATTGCAACCCAGAGAGG - Intronic
1195076782 X:101334928-101334950 CACCCCACCCCCACCCCTAGTGG + Intergenic