ID: 1081794383

View in Genome Browser
Species Human (GRCh38)
Location 11:45809567-45809589
Sequence CCTGAAGTCCAGATCGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081794383_1081794391 25 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794391 11:45809615-45809637 GAGTAGATTGGCTGGAGTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 258
1081794383_1081794388 13 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794388 11:45809603-45809625 TTGCAAGGTGGAGAGTAGATTGG 0: 1
1: 0
2: 4
3: 25
4: 255
1081794383_1081794387 1 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794387 11:45809591-45809613 TGATCATATCAGTTGCAAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 144
1081794383_1081794392 30 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794392 11:45809620-45809642 GATTGGCTGGAGTGGAGGACAGG 0: 1
1: 0
2: 5
3: 26
4: 294
1081794383_1081794390 22 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794390 11:45809612-45809634 GGAGAGTAGATTGGCTGGAGTGG 0: 1
1: 0
2: 3
3: 34
4: 309
1081794383_1081794386 -2 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794386 11:45809588-45809610 GGATGATCATATCAGTTGCAAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1081794383_1081794389 17 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794389 11:45809607-45809629 AAGGTGGAGAGTAGATTGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 302

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081794383 Original CRISPR CCTGAAGTCCAGATCGGTCC AGG (reversed) Intronic