ID: 1081794383

View in Genome Browser
Species Human (GRCh38)
Location 11:45809567-45809589
Sequence CCTGAAGTCCAGATCGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 67}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081794383_1081794390 22 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794390 11:45809612-45809634 GGAGAGTAGATTGGCTGGAGTGG 0: 1
1: 0
2: 3
3: 34
4: 309
1081794383_1081794389 17 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794389 11:45809607-45809629 AAGGTGGAGAGTAGATTGGCTGG 0: 1
1: 0
2: 1
3: 28
4: 302
1081794383_1081794391 25 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794391 11:45809615-45809637 GAGTAGATTGGCTGGAGTGGAGG 0: 1
1: 0
2: 2
3: 21
4: 258
1081794383_1081794386 -2 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794386 11:45809588-45809610 GGATGATCATATCAGTTGCAAGG 0: 1
1: 0
2: 1
3: 6
4: 99
1081794383_1081794392 30 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794392 11:45809620-45809642 GATTGGCTGGAGTGGAGGACAGG 0: 1
1: 0
2: 5
3: 26
4: 294
1081794383_1081794387 1 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794387 11:45809591-45809613 TGATCATATCAGTTGCAAGGTGG 0: 1
1: 0
2: 1
3: 8
4: 144
1081794383_1081794388 13 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794388 11:45809603-45809625 TTGCAAGGTGGAGAGTAGATTGG 0: 1
1: 0
2: 4
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081794383 Original CRISPR CCTGAAGTCCAGATCGGTCC AGG (reversed) Intronic
900180058 1:1307441-1307463 CCTGCAGTCCAGCTCTGGCCAGG - Intronic
901324794 1:8359926-8359948 CATGAAGTACAGGTCTGTCCGGG + Exonic
907797851 1:57735286-57735308 ACTGAAGTCCAGATAGGTGATGG - Intronic
918181348 1:182087946-182087968 CCAGATGTCCAGATCTGACCAGG - Intergenic
922092982 1:222415163-222415185 CCTCAAGGCCAGATAGGTACAGG - Intergenic
924611110 1:245574574-245574596 CCTGAACTCCAGAACCTTCCAGG - Intronic
1069836723 10:71313894-71313916 CCGGAAGTCCAGAACGTTCCTGG + Intergenic
1077043049 11:532988-533010 CCTGAACTCCAGGTCTGGCCAGG + Intronic
1077077695 11:708853-708875 CCTGAAGTCCAGAGGGAGCCCGG - Intronic
1080550750 11:33372067-33372089 CCTAGAGTCTAGAACGGTCCTGG + Intergenic
1081794383 11:45809567-45809589 CCTGAAGTCCAGATCGGTCCAGG - Intronic
1083940187 11:65891442-65891464 CCCGAGGTCCACAGCGGTCCCGG - Exonic
1089456383 11:118628199-118628221 CCTTAAGTCCATCTCTGTCCCGG + Exonic
1093975337 12:25415035-25415057 CCAAAAGTCCAGATCAGTGCTGG + Intronic
1097482988 12:60154668-60154690 CCTACAGTCCAGTTCAGTCCTGG - Intergenic
1102998065 12:117364852-117364874 CCTGAACCCCAGAGAGGTCCTGG - Intronic
1105705815 13:22966806-22966828 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1105858718 13:24391792-24391814 CCTGAAGTCCAGGCCAGCCCAGG + Intergenic
1123023111 14:105411474-105411496 CCTGCAGTGCAGCTGGGTCCCGG - Exonic
1124191383 15:27580162-27580184 ACTGAAGTCCAGATCTTACCTGG + Intergenic
1124381579 15:29172198-29172220 CCTGAAGTCCAGTTGGTCCCTGG - Intronic
1126790512 15:52217326-52217348 CCTGGAGCACAGCTCGGTCCTGG - Intronic
1130395811 15:83500451-83500473 CCTGAAGGCCACATTGGTCCAGG - Intronic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1138517068 16:57541972-57541994 CCTGAAGCCCAGAGAGGACCTGG - Intergenic
1142426826 16:90006036-90006058 CCTTACGTCCAGCTCGTTCCTGG - Exonic
1143220171 17:5255039-5255061 CCTGAAGGCCAGTTGGGTGCAGG - Intergenic
1160376397 18:78416110-78416132 CCTGCATTCCGGATGGGTCCTGG + Intergenic
1163644125 19:18478721-18478743 TCTGAAGTCCAGTTGGGTCTGGG - Intronic
1165715665 19:38044297-38044319 CCTGAAGTTGAGAGAGGTCCAGG + Intronic
1166338655 19:42123772-42123794 GCTGAAGCCCAGATTTGTCCTGG - Intronic
926427834 2:12755445-12755467 CCAGAAGTCCACATGGGTCCTGG + Intergenic
927972079 2:27312154-27312176 CCTTAAGTCTAGAACTGTCCTGG - Intronic
930090050 2:47525469-47525491 CCTGGAGTCCAGAGCTGTGCTGG + Intronic
932699650 2:73984501-73984523 CCTGCGGGCCAGATCTGTCCGGG - Intergenic
938307731 2:130266407-130266429 CCTGAGGTCCAGATGGACCCTGG - Intergenic
942855527 2:180542064-180542086 ACTGAAGTTTAGAGCGGTCCAGG - Intergenic
946153804 2:217793918-217793940 CCTGACTCCCAGATCGGTTCTGG - Intergenic
1171338929 20:24412045-24412067 CCTGAAGCCCAGATGAGTCAAGG - Intergenic
1172244773 20:33438386-33438408 CCTGAAGTCAAGAGCTCTCCAGG + Intronic
1173268646 20:41511037-41511059 ACTGAAGCCCAGAACGATCCAGG - Intronic
1174384605 20:50179674-50179696 CCTGAAGTCCAGCTGGAGCCTGG + Intergenic
1175388005 20:58609421-58609443 CCTGAGGTTCAGAGAGGTCCAGG - Intergenic
1181544079 22:23591166-23591188 CCTGAAGGCCAGAACTGTCTAGG - Intergenic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
951681934 3:25304028-25304050 ACTGAAGTCAAGATGGGTCTAGG - Intronic
955405974 3:58626040-58626062 CCTGAGGTCCAGAGGGGTTCAGG + Intronic
955909565 3:63846298-63846320 CCTGAAGTCCATTTTTGTCCAGG - Intronic
956026015 3:64983905-64983927 CCTGGAGGCCAGCTCAGTCCAGG - Intergenic
960939135 3:122922208-122922230 CCTGCAGTCCAGGTTGGACCGGG + Intronic
968649303 4:1754084-1754106 CCTGAAGTCCAGAGGACTCCAGG - Intergenic
986877859 5:12132619-12132641 CCTGTAGTCCAGATGCTTCCTGG - Intergenic
995469461 5:112485163-112485185 CCTGAAGTCCAGCTATTTCCAGG - Intergenic
1000102355 5:158028344-158028366 CCTGAAGTCCAGATAGTTTTAGG - Intergenic
1017008137 6:150043050-150043072 CTTGAAGGCCAGATGTGTCCAGG - Intergenic
1017738431 6:157383012-157383034 CCTGAAGTCCAGACTGTTTCTGG - Intronic
1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG + Intergenic
1019969561 7:4529262-4529284 CCTGAAGTCCTGAAGTGTCCTGG + Intergenic
1032217471 7:129968860-129968882 CCTGGAGTCCAGTTTGGTGCTGG - Intergenic
1034662466 7:152784114-152784136 CCTGAAATACAGATAGTTCCAGG - Intronic
1034993401 7:155562289-155562311 CCTGAAGTCCAGCTCCACCCGGG - Intergenic
1035748675 8:1979784-1979806 CCTGAAGTGCAGCTGGGTGCAGG + Intronic
1043383044 8:79723268-79723290 CCTCAAGCCCAGATTGGTCTGGG + Intergenic
1043666807 8:82825372-82825394 CCCAAAGTCCAGATGGGCCCAGG - Intergenic
1054349915 9:64012198-64012220 CCTGATGTCCAGCTGGGGCCTGG - Intergenic
1057753365 9:97810001-97810023 CTTGAAGTCCAACTCTGTCCTGG - Intergenic
1059681244 9:116588488-116588510 CCTGAAGTCTTAATGGGTCCTGG + Intronic
1060277677 9:122194151-122194173 CCTGAAGTGCACCTGGGTCCTGG + Intronic
1188441913 X:30221800-30221822 TGTGAAGTCCAGAACCGTCCTGG + Intergenic
1189889105 X:45580664-45580686 CCTAAAGTCCAGATCATTGCAGG + Intergenic
1198000730 X:132433162-132433184 TCTGAGGTGCAGATGGGTCCTGG + Intronic