ID: 1081794388

View in Genome Browser
Species Human (GRCh38)
Location 11:45809603-45809625
Sequence TTGCAAGGTGGAGAGTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 255}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081794381_1081794388 24 Left 1081794381 11:45809556-45809578 CCAGGGCACAGCCTGGACCGATC 0: 1
1: 0
2: 0
3: 5
4: 121
Right 1081794388 11:45809603-45809625 TTGCAAGGTGGAGAGTAGATTGG 0: 1
1: 0
2: 4
3: 25
4: 255
1081794383_1081794388 13 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794388 11:45809603-45809625 TTGCAAGGTGGAGAGTAGATTGG 0: 1
1: 0
2: 4
3: 25
4: 255
1081794385_1081794388 7 Left 1081794385 11:45809573-45809595 CCGATCTGGACTTCAGGATGATC 0: 1
1: 0
2: 0
3: 9
4: 202
Right 1081794388 11:45809603-45809625 TTGCAAGGTGGAGAGTAGATTGG 0: 1
1: 0
2: 4
3: 25
4: 255

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081794388 Original CRISPR TTGCAAGGTGGAGAGTAGAT TGG Intronic
900766243 1:4507644-4507666 TTGCCAGGTGGAGAGCAGAGCGG + Intergenic
900833281 1:4980320-4980342 TTCCAATACGGAGAGTAGATTGG - Intergenic
900860117 1:5222969-5222991 CTGCAAGGTGGAGGGTTGACAGG + Intergenic
901307228 1:8241406-8241428 CTGCAGGGTGGAGGGTACATTGG + Intergenic
901316841 1:8315480-8315502 TTGCAGAGGGGAGAGAAGATGGG - Intergenic
902176121 1:14652526-14652548 GTGGATGGGGGAGAGTAGATAGG - Intronic
905466700 1:38159817-38159839 TGGCTGTGTGGAGAGTAGATTGG + Intergenic
907661782 1:56399992-56400014 TTGCAGGGTGGAGTGAAGATCGG - Intergenic
909538043 1:76760401-76760423 TTGCAGGGTTGAGAGAGGATAGG + Intergenic
909581892 1:77246102-77246124 TTTCAAGATGGAGAGTGAATTGG + Intergenic
912584403 1:110749342-110749364 GTGCTATGTGGGGAGTAGATTGG + Intergenic
912858877 1:113195454-113195476 TTGCCCGGTGAAGAGGAGATGGG - Intergenic
913247112 1:116879564-116879586 TGGCAGGGTCGAGAGTCGATTGG + Intergenic
914094976 1:144537513-144537535 TCGCAAGTTGGAGAGTAGCCTGG + Intergenic
914303547 1:146396385-146396407 TCGCAAGTTGGAGAGTAGCCTGG - Intergenic
915016600 1:152739929-152739951 TTGCATTGTGAAGAGCAGATTGG - Intronic
915137369 1:153742411-153742433 TGGCAAAGATGAGAGTAGATGGG + Intronic
918897923 1:190371860-190371882 TTCCAAGGTGGAGATGTGATAGG - Intronic
918939090 1:190966636-190966658 TTGCAATGGAGAGATTAGATTGG - Intergenic
920347990 1:205318919-205318941 TAGAAAGGTGGAGAGAAAATTGG + Intronic
920452927 1:206073828-206073850 TTGCAATGTGGAGAATAGACTGG - Intronic
921527039 1:216230112-216230134 TTGCAAGGAGGACAGTGGGTTGG + Intronic
923415598 1:233756644-233756666 AGCCAAGGTGGAGAGTATATAGG + Intergenic
923597101 1:235368988-235369010 TTTAAAGGTGGAGAGTCCATAGG - Intronic
1065073452 10:22051788-22051810 CTGCAATGTGGAGAAAAGATGGG + Intergenic
1065165312 10:22970545-22970567 TTGCAAAGTGGAGAAGAGATTGG + Intronic
1068092018 10:52443607-52443629 CAGCAATGTGGAGACTAGATGGG - Intergenic
1068931849 10:62598382-62598404 TCGCAAGGTGGAAATTAGAGGGG - Intronic
1068990671 10:63147237-63147259 CTGCAAGGTGGGCAGTAGATTGG + Intronic
1070940087 10:80336918-80336940 TTATAAGGTGGAGAGAGGATTGG - Intronic
1071430662 10:85603873-85603895 CTGCAAGGTGGACAGGGGATGGG - Intronic
1071432047 10:85613791-85613813 CTGCAGTGTGGAGAGTAGACTGG - Intronic
1071755703 10:88536422-88536444 CTGCTATGTGGAGAATAGATTGG - Intronic
1071941907 10:90600024-90600046 CTGCAATGTGGAAAATAGATTGG - Intergenic
1074578331 10:114692467-114692489 TTGCAAGGAACAGAGTAGAAAGG - Intergenic
1075204282 10:120433416-120433438 TTGCCAGGAGCAGAGTGGATAGG - Intergenic
1077352988 11:2101333-2101355 CTGCAGGGTGGCGAGTAGAAAGG - Intergenic
1078027740 11:7714191-7714213 TTGGAGGGTGGAGGGTGGATGGG - Intergenic
1078390937 11:10934819-10934841 TTTTAAGGTGGAGAGAACATTGG - Intergenic
1078690941 11:13579786-13579808 TTGCAAAGGGGAGAGAAGAGTGG + Intergenic
1078955505 11:16189675-16189697 TTGCAGTGTGGTGAATAGATTGG + Intronic
1081794388 11:45809603-45809625 TTGCAAGGTGGAGAGTAGATTGG + Intronic
1082661740 11:55920427-55920449 TTGCAGTGTGGAGAGTGGTTGGG - Intergenic
1083363234 11:62125712-62125734 TTTCTAGGTGTAGAGTTGATGGG + Intronic
1086986272 11:93252603-93252625 TGGGGAGGTGGAGAGTAGAGTGG - Intergenic
1087132878 11:94683996-94684018 CAGCAAGGTGGAGAGAGGATAGG + Intergenic
1087373447 11:97314682-97314704 TTGGATGGTGGAGGGTAGAAGGG - Intergenic
1088430705 11:109755508-109755530 CTGCAATGTGGACAGTAAATTGG + Intergenic
1088963966 11:114699339-114699361 GTGCAGTGTGGAGAATAGATTGG - Intronic
1090430204 11:126639586-126639608 CTGCAAGCTGGAGATGAGATCGG + Intronic
1090465291 11:126928204-126928226 TTGCTAGGTAGAGAAGAGATGGG + Intronic
1093392610 12:18641082-18641104 GAGCAAGGTGCAGAGGAGATGGG - Intronic
1096969475 12:55653783-55653805 TTTCAAGGAGTAGAGTAGTTAGG - Intergenic
1100017918 12:90034585-90034607 ATGCAATGTGAAGAGGAGATTGG + Intergenic
1100152850 12:91762018-91762040 CTGCAAGGAGGAGAGTAGCAAGG - Intergenic
1101250513 12:102929631-102929653 CTGCAAGGTGGAGAGTGGAATGG + Intronic
1101999170 12:109545930-109545952 TTCCAAAGTGCAGGGTAGATCGG - Intergenic
1102391387 12:112551719-112551741 GTGCAGGGAGGAGAGGAGATGGG + Intergenic
1103466305 12:121144630-121144652 TTGCAGTGTAGAGAGTAGAGGGG + Intronic
1104011538 12:124934039-124934061 TAGCTAGGTGGAAATTAGATGGG - Intergenic
1104167540 12:126248472-126248494 CTGTTAGGTGGAGAGTAGCTGGG + Intergenic
1104239139 12:126970219-126970241 TTACAGGGAGGTGAGTAGATGGG + Intergenic
1106157018 13:27168972-27168994 TGGAATGGTGGAGAGAAGATGGG - Intronic
1107797077 13:44063817-44063839 CTGCTATGTGGAGAGTAGATTGG + Intergenic
1108444523 13:50493947-50493969 TTGCAGGGTGGAGAACAGATTGG + Intronic
1108486897 13:50935861-50935883 CTGCAGTGTGGAGAGTATATTGG + Intronic
1108585830 13:51869064-51869086 TGGCAAGGTGGAGAGGGGTTGGG - Intergenic
1110162847 13:72400127-72400149 TAGCCAGGTGGAGAATAGAGTGG - Intergenic
1110785972 13:79526450-79526472 TAGCAAGGAAGAGAGTAGAGAGG + Intronic
1112074728 13:95899108-95899130 TTACATGGTGGAAAGTAGAAGGG - Intronic
1112080976 13:95969950-95969972 CTGCAAGTGGGAGAGGAGATGGG + Intronic
1113487064 13:110662166-110662188 TTGCATGGTGCAGAGTGGGTCGG - Intronic
1114834895 14:26192411-26192433 TTGCAAGGTGGAGGGTATTTAGG - Intergenic
1116520718 14:45843534-45843556 AAGCAAGGTGGATAGTAGGTAGG + Intergenic
1117043263 14:51787273-51787295 TTGCTGTGTGGAGAGTAGATTGG + Intergenic
1118506910 14:66423509-66423531 TTGCAGTGTGGAGAATAGATGGG - Intergenic
1119004561 14:70911588-70911610 TTGTATGGTGGAAAGCAGATTGG + Intronic
1119496256 14:75082160-75082182 TTGAAAGGTTGAGAGTGGAGTGG - Exonic
1121868771 14:97387791-97387813 TAGCAAGGTAGACAGTACATGGG + Intergenic
1125411937 15:39415360-39415382 TTGCAATGTGGACAGCAGATTGG + Intergenic
1127517468 15:59710211-59710233 TTGCAAGGTTCTGAGCAGATTGG + Intergenic
1127695166 15:61439572-61439594 TTGAAAGGATGAGAATAGATAGG - Intergenic
1128359488 15:66951182-66951204 TTGGAAGATGGAAAGCAGATGGG - Intergenic
1129302961 15:74636944-74636966 CGGCAAGGTGTAGAGTATATGGG + Intronic
1129557561 15:76528701-76528723 CTGCAATGTGGTGAGTAGATTGG - Intronic
1130977835 15:88790816-88790838 TAGCAAGTTAGAGAGTTGATGGG - Intergenic
1131915837 15:97265239-97265261 TTGCATTGTGGAAAGTGGATTGG - Intergenic
1133652918 16:7829835-7829857 GTGGAAGGTGGAGAGAAGAGAGG - Intergenic
1136219762 16:28821343-28821365 TTGCAACGTGGAGAATGGAGTGG - Intergenic
1138633640 16:58319423-58319445 CAGCAAGGTGGAGGGTGGATTGG - Intronic
1138633838 16:58320661-58320683 TTGCTAGGTGGAGAGTAGCTTGG + Intronic
1140053777 16:71507076-71507098 GTGTGAGGTGGAGAGGAGATGGG - Intronic
1141307501 16:82880178-82880200 TTGCAAAGTGGAAAATATATAGG - Intronic
1143530379 17:7499542-7499564 GTGCAAGGTGGAGGCTAGAGAGG + Intronic
1143666013 17:8361189-8361211 TTCCGAGATGGAGAGAAGATAGG - Intergenic
1143692093 17:8577143-8577165 TAGCAGTGTGGAGAGTAGACTGG + Intronic
1143946223 17:10594990-10595012 TTGCTAGGTAGAGAGAAGAAAGG - Intergenic
1150169203 17:62974308-62974330 TTAAAAGGTGGAGAGGAGTTTGG + Intergenic
1151999127 17:77634272-77634294 CTGCAAGGTGGACAGTACTTAGG + Intergenic
1153248280 18:3095166-3095188 TTTCAAGGTGGAGAGAAGGTGGG + Intronic
1154123352 18:11669538-11669560 CTGCTTTGTGGAGAGTAGATTGG + Intergenic
1154378306 18:13827010-13827032 CTGCTAGGTGGAGGGTGGATGGG - Intergenic
1157721255 18:49926359-49926381 GTGCCAGGTGGAGAGAAGACAGG + Intronic
1157874459 18:51259591-51259613 TTTCAATGTGAAGAGTAGAGTGG - Intergenic
1158728487 18:59996968-59996990 TTGCAAGGTGGAAAAAAAATGGG - Intergenic
1159742173 18:72185326-72185348 TTGCTGTGTGGAGAATAGATTGG - Intergenic
1162022275 19:7873367-7873389 TTGGAAGGGGGAGGGAAGATGGG + Intronic
1163097507 19:15070498-15070520 GTGCATGGTGGAGAGATGATGGG + Intergenic
1163209315 19:15828970-15828992 GTGCATGGTGGAGAGATGATGGG - Intergenic
1163210372 19:15835946-15835968 GTGCATGGTGGAGAGATGATGGG - Intergenic
1164597736 19:29541250-29541272 TTGCAATGTGGAGATTGGAGAGG + Intronic
1165380020 19:35472595-35472617 CTGCAATGTAGAGAGTGGATGGG - Intergenic
1168447231 19:56430474-56430496 TTGGATGGTGGAAGGTAGATTGG + Intronic
925075890 2:1015120-1015142 TTGCCAGGTGGAGAAGAGACTGG + Intronic
926002035 2:9341046-9341068 TAGGAAAGTGGAGAGTACATTGG + Intronic
928076445 2:28269281-28269303 TTCCAAGATGGAGAGGAGAAGGG - Intronic
929083389 2:38144286-38144308 TTGCAAGATGGAATGTATATGGG - Intergenic
929247015 2:39713108-39713130 ATGCACGGAGGAGAGTAGAGTGG + Intronic
930228053 2:48814353-48814375 GTGAAAACTGGAGAGTAGATGGG - Intergenic
932074055 2:68646584-68646606 TTTCAAGGTCTAGAGTAGACAGG + Intronic
932280808 2:70490330-70490352 TCACAAGGTGGAAAGAAGATGGG - Intronic
933077314 2:77945162-77945184 TTACAAAGTAGAGAGTAGATTGG + Intergenic
934054603 2:88241256-88241278 TTGCAGGGAGGAGTGTAGAAGGG + Intergenic
936624031 2:114128752-114128774 GTGCAAGGAGGAGAACAGATTGG - Intergenic
937443100 2:121933619-121933641 TTACAAGGTGGAGAACTGATTGG - Intergenic
938060918 2:128253612-128253634 CTGAAAGGTGGAGAGAAGACGGG + Intronic
938409614 2:131053099-131053121 TTGCAAGGAGGAGGGTATACAGG + Intronic
940197587 2:151113161-151113183 TTGCAAGGTATAGTGTAGAGAGG + Intergenic
940631210 2:156241679-156241701 ATGGGAGGTGGAGAGTAGAATGG - Intergenic
940810075 2:158232821-158232843 TTTTAAGGTAGAGAGTAGAATGG + Intronic
941041879 2:160632544-160632566 GTGAAAGGTGGAGAGAAGAATGG - Intergenic
941622980 2:167799336-167799358 TTGCAAGGGGGAGGGTGGAGGGG - Intergenic
941773364 2:169365482-169365504 TTGCCAAATGGAAAGTAGATGGG - Intergenic
942417381 2:175773181-175773203 AGGCAAGGTGAAGAGTAGATTGG + Intergenic
943180176 2:184530631-184530653 CTGCAAGGTGGTGAGTGGAGTGG + Intergenic
943489451 2:188532523-188532545 TGGCTAGGTGAAGAGTATATGGG + Intronic
943525677 2:189014325-189014347 TTGAAATGGGGAGAGTAGCTTGG - Intergenic
944449889 2:199831930-199831952 TTATAGGGAGGAGAGTAGATAGG - Intronic
945691014 2:213035857-213035879 TTGCTATCTGGAGAATAGATTGG + Intronic
946401862 2:219472471-219472493 ATGCAACGTGGAGAGAAGACGGG - Intronic
948592786 2:239062080-239062102 TTGCATGTTGCAGTGTAGATGGG - Intronic
948742103 2:240054936-240054958 GTGGAAGGTGGTGAGTGGATGGG + Intergenic
948761485 2:240194616-240194638 TTGGAAGGTGGAGCGTAGTGGGG + Intergenic
1169178192 20:3538116-3538138 TGACAAGATGGAGAGTAAATAGG - Intronic
1170862092 20:20115623-20115645 TATGAAGGTGGAGAGTAGATTGG - Intronic
1171104523 20:22420124-22420146 TTGCAAGGTGGGGAGTAGCTTGG - Intergenic
1172842773 20:37912062-37912084 TAGCATGGTGGGGAGTAAATGGG - Intronic
1173303225 20:41822868-41822890 TTGCAAGATGTCAAGTAGATAGG + Intergenic
1173837546 20:46135874-46135896 GTGAAAGGTGGAGAGAAAATGGG - Intergenic
1173857924 20:46262802-46262824 TGGCAAGATGGAGAGTAGGCAGG - Intronic
1174050629 20:47765026-47765048 TTTGGAGGTGGAGAGAAGATGGG - Intronic
1174865991 20:54136112-54136134 TTGTAAGGGGGAAGGTAGATGGG + Intergenic
1175261470 20:57676882-57676904 CTGCAGGGTGGAGAATAGACGGG - Intronic
1175654448 20:60756612-60756634 TTGAGAGGTGGAAAGTAGAATGG + Intergenic
1175662863 20:60832079-60832101 TTGGAGGCTGGAGAGTAGAGGGG - Intergenic
1176904177 21:14479702-14479724 TTCACAAGTGGAGAGTAGATTGG + Intergenic
1177750945 21:25283246-25283268 TTGCAAAGAGGAGGGGAGATGGG + Intergenic
1177837774 21:26204668-26204690 GTGGATGGTGGAGAGTAGAATGG - Intergenic
1180166142 21:46030743-46030765 TTACACGGTGGAGAGTGGAAGGG - Intergenic
1180907148 22:19422426-19422448 CTGCTACGTGGAGACTAGATTGG - Intronic
1182078587 22:27512485-27512507 TTGGACGGTGGAGGGTAGAGAGG + Intergenic
1182806666 22:33077484-33077506 TAGTAATGTGGAGAGCAGATTGG + Intergenic
1184942448 22:47779096-47779118 TTGCAAGGTAGAGAATGGCTTGG - Intergenic
949695536 3:6689770-6689792 TTGAAAAGTGGAGAGAAAATAGG + Intergenic
949890756 3:8732297-8732319 TGGCCAGGTGGAGGGTGGATTGG - Intronic
950944875 3:16934638-16934660 CTGCCAGGTGGAGAGTAAACCGG + Intronic
953174260 3:40535204-40535226 CGGCAAGGTGAAAAGTAGATGGG - Exonic
953305141 3:41822045-41822067 TTTAAATGTGGAGAGTAGAGTGG - Intronic
954148720 3:48647134-48647156 TGGCAAGGTGGACAGTGGAGGGG + Intronic
955258509 3:57360101-57360123 TTTCAAAGGGGAGAGAAGATAGG - Intronic
955835028 3:63045102-63045124 TTGCTGGGTTGAGAATAGATGGG - Intergenic
955873039 3:63460071-63460093 TTGCTATGTGGAGAATAGCTTGG - Intronic
955928399 3:64030690-64030712 TTGCAAGGTGCACAGGAGGTTGG + Intergenic
956914903 3:73860694-73860716 TTGCAAGGTAGAGAATGGTTGGG + Intergenic
958844728 3:99252733-99252755 CTGCAAGGTGGAGAACAGAGTGG + Intergenic
959897163 3:111617808-111617830 TTGCAATGTGGTGAGCAGGTGGG - Intronic
961413134 3:126737709-126737731 TTGCCAGGTGGAGAGGAGGGAGG + Intronic
962017169 3:131453651-131453673 TTGTTAGGTGGAGAGAAAATTGG + Intergenic
963700286 3:148617720-148617742 TAGCAATGTGGAGAGTAAAGAGG - Intergenic
963745170 3:149118361-149118383 TTCCATTGTGGAGGGTAGATTGG - Intergenic
964362390 3:155912320-155912342 TTGGAAAGTGGAAAGCAGATGGG + Intronic
965443414 3:168745156-168745178 TTGAGAGTTGGAGAGTAGAAAGG + Intergenic
966728538 3:183130970-183130992 TTTCCAGGTGGAGAGCAGAGGGG - Intronic
967990732 3:195128405-195128427 TTGCATGGTGGAGATTAGATTGG - Intronic
968091717 3:195902124-195902146 TTGGAAGCTGGAAAGCAGATGGG + Intronic
970664093 4:18317664-18317686 TCACAGGGTGGAGAATAGATTGG + Intergenic
971302800 4:25455926-25455948 TTGGGAGGTGGAGAGTTGAAGGG - Intergenic
971304193 4:25465915-25465937 CTGCTGTGTGGAGAGTAGATGGG + Intergenic
971589162 4:28444959-28444981 TTGAAAGCTGGAAAGCAGATAGG + Intergenic
975919896 4:79372908-79372930 TTCCAATGTGATGAGTAGATAGG + Intergenic
976169248 4:82285954-82285976 TTACAATGTGGAAGGTAGATTGG + Intergenic
976970997 4:91102322-91102344 TTGCAAGGTTGAGAATAGGCAGG + Intronic
977499196 4:97817115-97817137 TTCCAAGGTGGAATGTAGCTGGG - Intronic
978227572 4:106355842-106355864 TTGCAAGGAGAAGAGGAGAGAGG + Intergenic
978264214 4:106803282-106803304 TTGGAATGTGGACAGTGGATTGG - Intergenic
978501426 4:109414208-109414230 TTGCAATGGGGAGAGGAGAAAGG + Intergenic
980178035 4:129370865-129370887 TTGCAAAGTGGAGAATATAGAGG + Intergenic
981206474 4:142046746-142046768 TGGGAATGTGGAAAGTAGATTGG + Intronic
982481216 4:155913151-155913173 CTGCAATGTGGAGACTAAATTGG - Intronic
983589184 4:169389144-169389166 TTGCAAGGCAGAGAGGAGAAAGG - Intergenic
984884156 4:184435297-184435319 TTGCAAGACGGAGAGGAGTTTGG - Intronic
985907363 5:2850911-2850933 TTGCAAGTTGAAGAATAGAACGG + Intergenic
987647415 5:20692089-20692111 TGGCAAGGAGAAGAGTAGACTGG - Intergenic
989461155 5:41699918-41699940 CTGAAAGGAGGAGTGTAGATGGG - Intergenic
989547996 5:42696980-42697002 TTGCAATGTGAAACGTAGATTGG + Intronic
990176947 5:53118573-53118595 TTGGAAGCTAGATAGTAGATGGG + Intergenic
990464702 5:56061054-56061076 TTGCAGTGTGGAGAGTGGACTGG + Intergenic
990727189 5:58768895-58768917 CTGCTATGTGGAGATTAGATGGG + Intronic
991925349 5:71699886-71699908 AGGCAGGGTGGTGAGTAGATAGG + Intergenic
992355975 5:75983861-75983883 TTGCAAGAAGGAGAGCAGAAAGG - Intergenic
992672061 5:79070353-79070375 GTGCAGGGTGGAGGGTAGGTGGG + Intronic
997887871 5:137647744-137647766 TAGCAAGGTGCAGAGAAAATGGG + Intronic
998394693 5:141811335-141811357 GTGCAAGGTGGAGAGGAGCATGG - Intergenic
998513920 5:142735995-142736017 TTACAAGGGGAAGAGCAGATGGG + Intergenic
998740289 5:145193051-145193073 TTGTCAGGTGGAGAGTAGAAGGG + Intergenic
1000357702 5:160416759-160416781 CTGCAATGTGGAGAATTGATTGG - Intronic
1001119466 5:168967852-168967874 TTGCATGGTGGGAAGTAGAGTGG - Intronic
1003201185 6:3962410-3962432 TTGGAAGCTGGAAAGCAGATGGG + Intergenic
1007818004 6:44538424-44538446 TTGCAAAGTGGAAAGTTTATGGG - Intergenic
1008117378 6:47567909-47567931 TTGCAATGTGGGGAGTAGATTGG + Intronic
1009423600 6:63490257-63490279 GTGTAAGGTTGAGAATAGATGGG + Intergenic
1010321797 6:74519218-74519240 CTGCAAGGTGGGGACTAGGTCGG - Intergenic
1011206021 6:84899029-84899051 TTGCCTGGTGGAGGGAAGATGGG - Intergenic
1011433327 6:87311563-87311585 TTTCAAGGTGGGGAATTGATAGG + Intronic
1012487241 6:99735884-99735906 TTGGAAGCTGGAAAGTACATGGG - Intergenic
1013148520 6:107420066-107420088 TTGAAAGCAGAAGAGTAGATAGG - Intronic
1013227779 6:108132918-108132940 CTGCAGGGTGGGGAGGAGATGGG + Intronic
1013358861 6:109374543-109374565 TGGCATTGTGGAGAGTAGATTGG - Intronic
1014384786 6:120786639-120786661 TTGCAATGTGGTGAGCAGAGGGG - Intergenic
1014409188 6:121093191-121093213 TTGCAACATGGAGGGTAGGTTGG + Intronic
1015286667 6:131493060-131493082 TAGCACGGCGGAGAATAGATTGG - Intergenic
1015660938 6:135572535-135572557 TTGCAAGATGGAAAGTACAAAGG - Intergenic
1016753072 6:147652361-147652383 TTGCTAGGTTGAGAGGAGAAAGG - Intronic
1018705195 6:166459228-166459250 TTCCAAGGTGGAGGTTATATAGG + Intronic
1018991526 6:168677372-168677394 GTGCATGGTGGAGAGATGATGGG + Intergenic
1019288632 7:236277-236299 CTGCAAGGTTGAGAGGAGAGGGG - Intronic
1020213799 7:6173616-6173638 TTGCTGGGTGTAGAGTGGATGGG - Intronic
1021819260 7:24480068-24480090 AGGCAAGGTGGAGAATAGATAGG - Intergenic
1022553331 7:31263338-31263360 TTTGAAGCTAGAGAGTAGATTGG - Intergenic
1023438275 7:40160567-40160589 TTGAAAAGTGAAGAGCAGATAGG + Intronic
1023711387 7:42996887-42996909 TTGCTGGTTGGAGCGTAGATGGG - Intergenic
1026898200 7:74022574-74022596 TTGCAACGTGGAGAGCCGCTTGG - Intergenic
1027696156 7:81413231-81413253 TTTCATGGTGGAAAGAAGATGGG + Intergenic
1028772409 7:94641397-94641419 TAGCAAGGTGGACAGAAGGTTGG + Intronic
1031889833 7:127281343-127281365 TTGCAAGGAGGAGAGAGCATGGG - Intergenic
1032306823 7:130741856-130741878 TAAGAAGGTGAAGAGTAGATCGG - Intergenic
1032553242 7:132805345-132805367 TTCCAAGGAAGAGAGGAGATGGG + Intronic
1035400153 7:158559518-158559540 TCGCAGGGTGCAGAGGAGATAGG + Intronic
1035707330 8:1686693-1686715 CATGAAGGTGGAGAGTAGATTGG + Intronic
1037947327 8:22997517-22997539 TTCCAAGGTGTAGTGTTGATTGG - Intronic
1041593962 8:59624269-59624291 TTGTAACGTGCAGTGTAGATGGG + Intergenic
1041981396 8:63865142-63865164 TTGAAAGGTGGAGACAAGAAGGG - Intergenic
1042579609 8:70262437-70262459 TTACAAAGAGGAGAGAAGATGGG + Intronic
1042700112 8:71602853-71602875 TTGCAAGGTGTAAAATAGATTGG + Intergenic
1045414173 8:101950211-101950233 TTGGAAGCTGGAAAGCAGATGGG + Intronic
1047360306 8:124162900-124162922 ATGATAGGTGGAGAGAAGATTGG - Intergenic
1047625940 8:126656265-126656287 TTGCAAGGTGGAGATTAGTAGGG - Intergenic
1048612033 8:136033496-136033518 TTGCAAGGTTTTGAGTAGAAGGG + Intergenic
1051828695 9:21251518-21251540 TTGGAAGGAGGAGAGAAGACTGG - Intergenic
1052012388 9:23425745-23425767 CTGTAAGGTGAAGAATAGATTGG - Intergenic
1052993189 9:34534350-34534372 TGGCAAGGTGGGGAGAAGAAGGG + Intergenic
1053389940 9:37727470-37727492 GTGCAAGTTGGAGAACAGATGGG + Intronic
1055823325 9:80294473-80294495 TTGCAAGGAGGGGAGTAGGTAGG + Intergenic
1056387238 9:86107227-86107249 TATGAAGGTAGAGAGTAGATTGG + Intergenic
1058760691 9:108128622-108128644 TTGGAAGATGGAAAGCAGATGGG + Intergenic
1059872129 9:118589010-118589032 TTGCAAGTTGAAGAGGACATAGG + Intergenic
1060235634 9:121860682-121860704 TCACATGGTGGAGAGTAGAGAGG - Intronic
1060503384 9:124179968-124179990 CTGAAAGATGGAAAGTAGATAGG - Intergenic
1061633374 9:131888681-131888703 TTGCAAGGTGAACAGGTGATAGG + Intronic
1062141518 9:134961630-134961652 TGCCAAGGTGGAGAGAAGGTGGG - Intergenic
1185477505 X:424261-424283 TGGCAAGGTGGAGGGTTGAAGGG + Intergenic
1186059925 X:5693816-5693838 TTGCAAGCTAGAAAGCAGATGGG + Intergenic
1186413329 X:9362541-9362563 TGGCAAGGAGGAGGGTGGATTGG - Intergenic
1186721899 X:12313395-12313417 TTGCAAAGTGGGGAATAGAAAGG + Intronic
1187212040 X:17241394-17241416 TTGGGAGGTGCAGAGTAGACTGG - Intergenic
1188402262 X:29760135-29760157 TTGCGAGATGGGGAGTGGATAGG + Intronic
1188564278 X:31508094-31508116 TTGACAGGTGGAAAGTACATAGG + Intronic
1188580413 X:31705151-31705173 TTGCTAATTGGAGAGTAGATTGG + Intronic
1191780432 X:64858442-64858464 TTGCAGGTTGGAGAGTAGGGTGG - Intergenic
1192061241 X:67829374-67829396 TTGAAAGGTAGAGAGTAGGAGGG - Intergenic
1196834156 X:119799344-119799366 TGGCCAGCTGGAGAGTAGATGGG + Intergenic
1197924506 X:131632645-131632667 TTGAAGGGTGGAGAATAAATGGG + Intergenic
1199696897 X:150348949-150348971 TTACAGGGTGGAGAGAAGAAGGG - Intergenic
1202389160 Y:24352161-24352183 TTGCAAGGTAGAGAGTCTGTGGG - Intergenic
1202481627 Y:25317963-25317985 TTGCAAGGTAGAGAGTCTGTGGG + Intergenic