ID: 1081794390

View in Genome Browser
Species Human (GRCh38)
Location 11:45809612-45809634
Sequence GGAGAGTAGATTGGCTGGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 347
Summary {0: 1, 1: 0, 2: 3, 3: 34, 4: 309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081794383_1081794390 22 Left 1081794383 11:45809567-45809589 CCTGGACCGATCTGGACTTCAGG 0: 1
1: 0
2: 0
3: 3
4: 67
Right 1081794390 11:45809612-45809634 GGAGAGTAGATTGGCTGGAGTGG 0: 1
1: 0
2: 3
3: 34
4: 309
1081794385_1081794390 16 Left 1081794385 11:45809573-45809595 CCGATCTGGACTTCAGGATGATC 0: 1
1: 0
2: 0
3: 9
4: 202
Right 1081794390 11:45809612-45809634 GGAGAGTAGATTGGCTGGAGTGG 0: 1
1: 0
2: 3
3: 34
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081794390 Original CRISPR GGAGAGTAGATTGGCTGGAG TGG Intronic
901307229 1:8241415-8241437 GGAGGGTACATTGGCGAGAGCGG + Intergenic
901818822 1:11812344-11812366 GGAGGGTAGCGTGCCTGGAGAGG - Intronic
902608783 1:17584784-17584806 GGAGATCAGTGTGGCTGGAGTGG + Intronic
903661742 1:24982690-24982712 GGAAAGTGGAGTGGCTGGAGGGG - Intergenic
904305977 1:29590496-29590518 AGAGAGAAGCTTGGTTGGAGGGG + Intergenic
904569698 1:31453788-31453810 GGTGAGTAGTTTGGCAGGAAGGG + Intergenic
904571814 1:31471630-31471652 GGTGAGAAGTTTGGCGGGAGGGG + Intergenic
905032585 1:34897486-34897508 GGAGTCTAGTGTGGCTGGAGTGG + Intronic
905205780 1:36342150-36342172 GGAGTTGAGGTTGGCTGGAGGGG - Intronic
905466702 1:38159826-38159848 GGAGAGTAGATTGGAAGGATTGG + Intergenic
905917752 1:41697599-41697621 GGAGAGCGAGTTGGCTGGAGAGG + Intronic
906936297 1:50216707-50216729 AGAGAGCAGGTTGGCTGGAAAGG - Intergenic
906989556 1:50723535-50723557 GGAGAGTAGAGTGGCTAGAATGG + Intronic
907853783 1:58281531-58281553 GTAGAGTGGATTGGAGGGAGGGG - Intronic
908378210 1:63567723-63567745 GGAGACCAGGTTGGATGGAGAGG + Intronic
909131261 1:71739971-71739993 GAAGAGAAGAATGTCTGGAGTGG - Intronic
909601322 1:77464456-77464478 GGAGAGGAGATTGGTTCCAGTGG + Intronic
909902649 1:81157490-81157512 GGAGAGGAGATTGGGAGGTGGGG + Intergenic
910765722 1:90780315-90780337 GGAGGGTAGTGTGGCTGGAAGGG + Intergenic
911409321 1:97482833-97482855 GGAGAATAAATTTGCTTGAGAGG - Intronic
912176545 1:107165020-107165042 GGTGAGTAGTTTGGCGGGAAGGG + Intronic
912932900 1:113980471-113980493 GGAGAGTGGATCGTCTGGAGCGG + Exonic
914256259 1:145962621-145962643 GGAGAGAAGCTTGGCGGGGGGGG + Exonic
915517739 1:156422880-156422902 GGAGAGTAGAGTGGGTAGAAGGG - Intronic
915921062 1:159975458-159975480 GGAGTGTGGCATGGCTGGAGAGG + Intergenic
916411709 1:164552728-164552750 GGTGAGTAGTTTGGCAGGAAGGG + Intergenic
919075106 1:192803779-192803801 GGAGAGTGGGATGGCTAGAGGGG - Intergenic
919735542 1:200948037-200948059 GGAGAGTGGGTTACCTGGAGTGG + Intergenic
920430027 1:205912827-205912849 GGAGAGAAGATTGGGCTGAGGGG - Intergenic
920691534 1:208150588-208150610 GGTGGGGAGATTGGCTGGTGAGG + Intronic
920825696 1:209422644-209422666 AGAGGGAAGATTGGCAGGAGAGG - Intergenic
922324117 1:224512716-224512738 GGAAGGTAAATGGGCTGGAGGGG - Intronic
923109559 1:230879893-230879915 GGAGAGCAGGGTGACTGGAGAGG - Intergenic
923305149 1:232681742-232681764 GGAGAGGAGACAGGATGGAGGGG + Intergenic
1063947367 10:11191269-11191291 GGAGAGTAAATGGGCAGGAGTGG + Intronic
1064381004 10:14841864-14841886 GGTGAGTAGATGGGCTGGGAGGG - Intronic
1064808595 10:19166823-19166845 GGAAACTAGATTGGATGGAGTGG + Intronic
1066132857 10:32410834-32410856 GGAGGCCAGAGTGGCTGGAGTGG + Intergenic
1067460318 10:46453343-46453365 GGAGAGTAGTGTGGCTGGATTGG - Intergenic
1067626872 10:47931260-47931282 GGAGAGTAGTGTGGCTGGATTGG + Intergenic
1069580062 10:69559689-69559711 GGAGAGGAGGGTGCCTGGAGGGG + Intergenic
1069618801 10:69823650-69823672 GGAGAGTGAATGGGCTGGGGTGG + Intronic
1070276026 10:75007577-75007599 GGAGAGGTGATTGGCTGGAGCGG + Intronic
1071136769 10:82462602-82462624 GAAGAGGAGATGGGCTGGACAGG + Intronic
1071268766 10:83987550-83987572 GGAGTGCACATTGGCTGGTGGGG - Intergenic
1073026354 10:100489867-100489889 GGAGTGTAGATGGTCTGCAGAGG - Intronic
1073835616 10:107437796-107437818 GTGGAGCAGAGTGGCTGGAGTGG + Intergenic
1073984343 10:109191480-109191502 GGAGAGTAGATTGTTTGCACAGG + Intergenic
1075574356 10:123568061-123568083 GGAGAGCAGACTGGCTAGAGCGG - Intergenic
1075979534 10:126724762-126724784 GGAGGGTAGATGGGGTGCAGCGG - Intergenic
1077238969 11:1500760-1500782 GGAGAGTGGATTGGAGGGTGGGG - Intronic
1077499957 11:2904839-2904861 AGAGAGCAGAGTGGCTAGAGTGG + Intronic
1078004833 11:7524762-7524784 GGAGAGTGGATTGGCCTGAGGGG + Intronic
1081794390 11:45809612-45809634 GGAGAGTAGATTGGCTGGAGTGG + Intronic
1081948836 11:47024351-47024373 AGAGAGAAGATTGGGTGAAGTGG - Intronic
1083187634 11:61026852-61026874 GGAAAGGTGATAGGCTGGAGGGG + Intergenic
1083433991 11:62630335-62630357 GGAGAGTTGATTGGCCAGCGGGG - Intronic
1083543823 11:63534503-63534525 GGAGACTGGCCTGGCTGGAGAGG - Intergenic
1083795869 11:65016353-65016375 GGAGGGCAGTATGGCTGGAGTGG + Intronic
1085257981 11:75187456-75187478 GGAGTGAAGATTGACTGGATTGG + Intronic
1086150546 11:83605193-83605215 GGAGAGGAGATTGGCTTTATAGG - Intronic
1087060958 11:93977174-93977196 GGAGGGTAGTGTGCCTGGAGAGG - Intergenic
1087198566 11:95322599-95322621 AGAGAGCAAATTGGCAGGAGGGG - Intergenic
1087306920 11:96499655-96499677 GGAGACTGGAGTGGCCGGAGCGG - Intronic
1089459465 11:118644186-118644208 GGAGAGCAGGTGGGCTGGCGGGG - Intronic
1089462943 11:118663293-118663315 GGAGAGAAGGTTCTCTGGAGAGG + Intronic
1089858195 11:121565891-121565913 AGAGAAAAGATTGGCAGGAGTGG + Intronic
1090061679 11:123469123-123469145 GGCAAGTAGAAGGGCTGGAGTGG + Intergenic
1091204303 11:133809124-133809146 AGAGAGCAGGGTGGCTGGAGAGG - Intergenic
1091225358 11:133953855-133953877 GGAGAAGAGAGGGGCTGGAGTGG - Intronic
1091406489 12:212833-212855 GGAGACTCGAGGGGCTGGAGAGG - Intronic
1092990324 12:13890991-13891013 GGAGCGGAGATTGGCTGGCTTGG - Intronic
1093721431 12:22446881-22446903 GGGGAGTAGACTGACTGCAGAGG + Intergenic
1094347052 12:29482194-29482216 CCAGAGTTGAGTGGCTGGAGAGG - Intronic
1094783937 12:33823909-33823931 GGAGAGAGGATTAGCTGCAGAGG + Intergenic
1096480066 12:51934222-51934244 GGAGTCCAGAGTGGCTGGAGGGG - Intergenic
1096806354 12:54143492-54143514 GGAGAGGAGAGGGGCTGGGGGGG - Intergenic
1096826387 12:54281368-54281390 GGAGACTAGAGTGGGGGGAGGGG - Exonic
1097424684 12:59428684-59428706 GGAGAGAAGAATGGGTGGATGGG - Intergenic
1098816824 12:75176253-75176275 GGAGAGAAGAAGGGCTGGAGTGG - Intronic
1098819738 12:75212083-75212105 GTAAAGTTCATTGGCTGGAGGGG - Intergenic
1100151449 12:91742936-91742958 GGAGAGTAGAATGAATGGAATGG - Intergenic
1101304315 12:103512714-103512736 AGAGAGTAGGCTGGCTGCAGTGG + Intergenic
1102541285 12:113621172-113621194 GAAGCCCAGATTGGCTGGAGAGG + Intergenic
1102749366 12:115278867-115278889 GGAGAGTACAAGTGCTGGAGGGG + Intergenic
1103445965 12:120995397-120995419 GGAGAGAAGAGTGGGTAGAGTGG - Intronic
1104954502 12:132457699-132457721 GGTGAGTGGATTGGGTGGACAGG + Intergenic
1105024045 12:132836989-132837011 GGAAACTAGACTGGCTGGCGGGG + Intronic
1110607940 13:77454894-77454916 GGAGTGGAGAGGGGCTGGAGAGG - Intergenic
1112484783 13:99810513-99810535 GAAGCGAAGCTTGGCTGGAGCGG + Intronic
1113604332 13:111594814-111594836 GGAGGGTGGATGGGATGGAGGGG - Intronic
1114430857 14:22659162-22659184 GGAGAGCAGAGATGCTGGAGGGG - Intergenic
1117217685 14:53568686-53568708 AGAGATTAAATTGGCTGGACAGG + Intergenic
1117758761 14:59004219-59004241 GGAGAGTGGCTTGCCTAGAGAGG - Intergenic
1118827005 14:69393024-69393046 TTAGAGTAGATGGCCTGGAGTGG + Intronic
1119412548 14:74442802-74442824 AGAGATTAGATGGGTTGGAGTGG + Intergenic
1119767465 14:77199450-77199472 GCAGACTAGCTTGGCTGAAGAGG - Intronic
1121119171 14:91365131-91365153 GGAGAGCACTTAGGCTGGAGGGG - Intronic
1121487709 14:94331318-94331340 GAAGTGCAGATTGGCAGGAGAGG - Intergenic
1121717402 14:96086205-96086227 GGGGAGGGGAATGGCTGGAGGGG + Intronic
1121874690 14:97440577-97440599 AGAAAGTACAGTGGCTGGAGAGG + Intergenic
1121927292 14:97939498-97939520 GGAGGGTAGAAGGGCTGTAGTGG - Intronic
1122782120 14:104148072-104148094 GGGCAGTGGCTTGGCTGGAGTGG + Intronic
1125182627 15:36895071-36895093 GGATAGTAGAGTGGATGGAGAGG + Intronic
1126171933 15:45702296-45702318 GGAGAGTAGATTGGAGGGAGAGG + Intergenic
1130970645 15:88729360-88729382 GGAGAGCAACCTGGCTGGAGGGG + Intergenic
1132075429 15:98816075-98816097 GGAAAGTAGGGTGGCTGGGGTGG - Intronic
1132460669 16:52882-52904 GGAGAATAAATTGGAAGGAGGGG + Intronic
1133853288 16:9526079-9526101 GAAGATCAGAATGGCTGGAGTGG + Intergenic
1134421119 16:14090961-14090983 TGACAGTTGCTTGGCTGGAGAGG + Intronic
1135542670 16:23344283-23344305 GGAGATTAGAAGGGTTGGAGAGG + Intronic
1135705459 16:24671018-24671040 GGAAAGGAGATTGGCTGGCGAGG - Intergenic
1136418103 16:30115652-30115674 GGAGATTAGAATGGCTTGTGGGG + Intronic
1138119136 16:54384202-54384224 GGAGACGGGAGTGGCTGGAGTGG - Intergenic
1138727182 16:59152636-59152658 GCATAATAGATTGGGTGGAGTGG - Intergenic
1138853316 16:60656624-60656646 TGAGAGTAGATGAGCTGGAAGGG + Intergenic
1139360753 16:66398273-66398295 GGGGAGTAGATTGGCGGGGCAGG + Intronic
1139514883 16:67447057-67447079 AAAGAGGAGATTGGCTGGTGGGG - Intronic
1140389463 16:74572601-74572623 GGAGAGTGGCCTGCCTGGAGAGG + Intronic
1143190307 17:5035459-5035481 GGAGAGGGGAGTGGCTGGGGCGG + Intronic
1145351891 17:22090886-22090908 AGAGAGTAGCGCGGCTGGAGCGG + Intergenic
1147045493 17:37748763-37748785 GGAGAGTGGAGTGGCAGGGGTGG - Intergenic
1148430586 17:47640017-47640039 GGTGAGAAGATTGGCTGGGCAGG + Intergenic
1148643016 17:49202285-49202307 GGAGAGCAGATGAACTGGAGAGG - Intergenic
1148792943 17:50183747-50183769 GGAGAGTGGATGGGCTTGAAGGG + Exonic
1148824215 17:50380348-50380370 GGAGAGTGACTGGGCTGGAGGGG + Exonic
1149483550 17:57023315-57023337 AGAGAGTAGCATGCCTGGAGAGG + Intergenic
1150430440 17:65111556-65111578 GGAGAGTGGTGTGCCTGGAGAGG - Intergenic
1150938199 17:69660338-69660360 GGAGGGTGGGATGGCTGGAGAGG + Intergenic
1151152739 17:72101846-72101868 GGAGAGTTGCTTGGCTTGACTGG - Intergenic
1151599571 17:75097964-75097986 GAGGAGGAGAGTGGCTGGAGAGG - Intronic
1152036806 17:77878557-77878579 GGGGAGAAGATTGACTGCAGAGG - Intergenic
1152435017 17:80271118-80271140 GGAGGGTAGGTTGGTGGGAGGGG + Intronic
1153032854 18:731333-731355 GGAGAGGAGTTTTGTTGGAGAGG + Intronic
1153169811 18:2303099-2303121 GGTGAGTAGTTTGGTGGGAGGGG - Intergenic
1153195863 18:2595704-2595726 GTAGAGTAAATTGGCTTAAGAGG + Intronic
1153786372 18:8538635-8538657 GGAGAAAACATGGGCTGGAGAGG - Intergenic
1155293728 18:24366371-24366393 GGAGGGTAGAGGGGCTGAAGGGG - Intronic
1155344229 18:24842873-24842895 TGAAAGTAGATTGCCTTGAGGGG + Intergenic
1155934267 18:31739109-31739131 GGTGAGTAGTTTGGCGGGAAAGG - Intergenic
1155984905 18:32219551-32219573 GAAGAGTAGAAGGGCAGGAGGGG + Intronic
1156140004 18:34097245-34097267 GAAGAGAAGATTGGTGGGAGTGG - Intronic
1156382622 18:36578004-36578026 GGAGATCAGAGTGGCTGTAGTGG + Intronic
1157503066 18:48204248-48204270 GCAGAGTTGGTTGGGTGGAGAGG - Intronic
1159855157 18:73578370-73578392 GGAGAGTAGATCTGATGAAGTGG - Intergenic
1160622937 18:80183358-80183380 GGAGAGTTGTCTGGCTGGAAAGG - Intronic
1162070267 19:8148794-8148816 GGAGGGTTGGCTGGCTGGAGAGG + Intronic
1162540658 19:11293994-11294016 GGAGGGTAGAGGGGCTGGGGCGG + Intergenic
1162738768 19:12761853-12761875 GGGGACCAGAGTGGCTGGAGTGG - Intergenic
1162962676 19:14137070-14137092 TGAGAGTTTATTGGCTGGATTGG + Intergenic
1164437219 19:28240883-28240905 GATGAGTAGTTTGGCTGGAGAGG + Intergenic
1165273580 19:34731064-34731086 GGAGATGAGATTTCCTGGAGAGG - Intergenic
1165286567 19:34847610-34847632 GGAGCTGAGAGTGGCTGGAGAGG - Intergenic
1165794659 19:38511880-38511902 GGAGAGTGGTTGGGCTGGGGAGG + Intronic
1167447174 19:49544423-49544445 GGAGGCTAGAGTGGCTGGAAGGG + Intronic
1167571184 19:50290134-50290156 GGAGAGGAGATGGGTTGGAAGGG - Intronic
925710068 2:6730683-6730705 GGAATGTTGATTAGCTGGAGTGG - Intergenic
927280782 2:21304604-21304626 GGAGAGTATTGTGGTTGGAGAGG + Intergenic
929017289 2:37511169-37511191 GGAGAGGGGATTGACTGGGGTGG + Intergenic
931730256 2:65147079-65147101 GGAAAGTATAATGGGTGGAGGGG - Intergenic
931835248 2:66092315-66092337 AGAGAGCAGATTGGGTGGTGTGG + Intergenic
932489984 2:72114352-72114374 GGTGACTAGATTAGCTGGTGGGG - Intergenic
934539451 2:95161875-95161897 GGAGAGTGTATAGGCTGGTGAGG - Intronic
936150726 2:110020663-110020685 GGAGAGTATATCAACTGGAGCGG + Intergenic
936193950 2:110350706-110350728 GGAGAGTATATCAACTGGAGCGG - Intergenic
937237384 2:120438886-120438908 GGAGATGAGAGAGGCTGGAGGGG - Intergenic
940418941 2:153455987-153456009 GGAGAAGAATTTGGCTGGAGAGG - Intergenic
941442604 2:165556533-165556555 GGAGAGAAGGTTGGATGAAGAGG + Intronic
941604907 2:167584823-167584845 GGAGGGTAGTGTGACTGGAGAGG - Intergenic
941649560 2:168079255-168079277 GGAGAGGACCTAGGCTGGAGAGG - Intronic
942524043 2:176833942-176833964 GGAGAGTAGGCTGGTTAGAGGGG - Intergenic
944900957 2:204215619-204215641 GGAGATCAGTATGGCTGGAGTGG - Intergenic
945986997 2:216363003-216363025 GGAGAGGAGGTTGGAGGGAGAGG - Intronic
946415110 2:219536345-219536367 CAAGTGTAGACTGGCTGGAGGGG - Intronic
946559509 2:220896969-220896991 GGAGAGTAGTCTGGAAGGAGAGG - Intergenic
947693807 2:232165444-232165466 GGAGAGTGGATTCAGTGGAGTGG + Intronic
948209368 2:236181011-236181033 GGAGAGTAGGTTGGTGGGAGAGG + Intergenic
1168818853 20:760251-760273 GGAGAGATGATTTGCTGGTGGGG - Exonic
1168845414 20:941207-941229 AGAGAGCAGTGTGGCTGGAGTGG + Intergenic
1169027749 20:2384768-2384790 GGAGAGCAGACAAGCTGGAGGGG + Intronic
1169115764 20:3064663-3064685 GGAGTGTTTATTGGCTGGGGTGG + Intergenic
1169291360 20:4355817-4355839 GAAGAATAGATTGGCTGGAGTGG - Intergenic
1170066163 20:12312802-12312824 GGAGAGTAGAATGGCCTGAGAGG - Intergenic
1170561830 20:17565102-17565124 GGAGTGGAGATTGACTGCAGAGG - Intronic
1170613162 20:17930079-17930101 GGAGGGCAGGTGGGCTGGAGTGG - Intergenic
1170767902 20:19307038-19307060 GGTGAGGATATTGGTTGGAGTGG + Intronic
1172573330 20:35987167-35987189 AGAGGGGAGCTTGGCTGGAGGGG + Intronic
1173533581 20:43790468-43790490 GGATCGAAGATTGACTGGAGGGG - Intergenic
1173860696 20:46281351-46281373 GAAGAGTAGAGTGGCTGGACTGG + Intronic
1174837962 20:53876116-53876138 GGAGAATGGATTCGCTGGAGAGG - Intergenic
1175853603 20:62107067-62107089 GGAGACCAGAGTGGCTGGAGGGG - Intergenic
1178237293 21:30857664-30857686 GGAGGGTAGAGTGCCTGGGGAGG - Intergenic
1178809708 21:35870292-35870314 TGAGAGTTGATTGGTTAGAGAGG - Intronic
1180901413 22:19376137-19376159 GGAAAGGTGAGTGGCTGGAGTGG - Intronic
1180907144 22:19422417-19422439 GGAGACTAGATTGGTTGTGGGGG - Intronic
1180993123 22:19950616-19950638 GGGGAGTTGAGGGGCTGGAGGGG + Intronic
1181463123 22:23096954-23096976 TGAGAGTGGAGTTGCTGGAGAGG + Intronic
1182058453 22:27379547-27379569 GGAGGGCAGGTGGGCTGGAGAGG + Intergenic
1183301799 22:37062417-37062439 GGAGAGGAGATTGACGGGTGGGG - Intronic
1183742400 22:39676041-39676063 GGAGAATGGATTGGAGGGAGAGG + Intronic
1184154868 22:42660856-42660878 GGAGGGTAGTGTGCCTGGAGAGG - Intergenic
1184324997 22:43776157-43776179 GGAGATAAGAGAGGCTGGAGTGG + Intronic
1184502111 22:44880536-44880558 GGAGAATAGTTTGGGAGGAGGGG - Intergenic
1184782715 22:46657151-46657173 GGAGGGTGGATGGGCTGGGGTGG + Intronic
1184946532 22:47807896-47807918 AGGGAGTAGGTTGGCTGGATGGG + Intergenic
1185063872 22:48621080-48621102 GGATAGTAGATTGGGTGGGTGGG - Intronic
949324793 3:2851319-2851341 GGAGAGGAGAGTGCCTGGAGAGG - Intronic
949494644 3:4620160-4620182 GGAGAGAAGCCTGGCTGGGGTGG + Intronic
950058009 3:10043954-10043976 AGAGAGAAGAGTGACTGGAGGGG - Intronic
950371675 3:12536176-12536198 GCAGAGGAGATTGGGAGGAGAGG + Intronic
951496338 3:23331675-23331697 GGAGATTAGAGTGACTGGAGAGG + Intronic
951922576 3:27872531-27872553 GGAGAGTAGCAGGCCTGGAGAGG + Intergenic
952801739 3:37299101-37299123 GGAGAGGAGAGTGGATGGAAAGG + Intronic
954111765 3:48437540-48437562 GCAGAGAAGAGTGGATGGAGAGG + Intronic
956460124 3:69463175-69463197 GAAGAGTGGATTGACTGGTGAGG - Intronic
959349698 3:105246557-105246579 GGAGTGTAGATTGGTGGGTGTGG + Intergenic
959945658 3:112123186-112123208 GGAGAGTATAGTGGTAGGAGGGG - Exonic
960240156 3:115331360-115331382 GGAGAGTGGCATGGCTGGGGAGG + Intergenic
960456393 3:117878183-117878205 GGAGGGTAGTGTGCCTGGAGAGG + Intergenic
961327733 3:126119235-126119257 CCAGAGGAGTTTGGCTGGAGAGG - Intronic
961736563 3:129005396-129005418 GGAGGCCAGAGTGGCTGGAGGGG + Intronic
962320578 3:134387311-134387333 TGAGAGTGGCTTGGCTGGTGGGG + Intergenic
963968515 3:151401987-151402009 GGGCAGAAGATTGGATGGAGGGG + Intronic
965274472 3:166663404-166663426 GGTGAGTAGTTTGGCAGGAAGGG - Intergenic
966055869 3:175688675-175688697 GGAGAGGAGGGTGGATGGAGGGG + Intronic
967210239 3:187162096-187162118 GGAGAGGAAAGTGGATGGAGAGG - Intronic
967877158 3:194275393-194275415 GGAGATTTGTGTGGCTGGAGAGG + Intergenic
967878942 3:194285589-194285611 GTCGAGTATATTGGCCGGAGAGG + Intergenic
967884320 3:194322784-194322806 AGAGAGTAGGATGGCTGGGGAGG + Intergenic
971376155 4:26057312-26057334 GGAGAGTGGACTGGGTGCAGTGG - Intergenic
973726967 4:53786680-53786702 GGAGAGAAGGTGGGCTGCAGAGG - Intronic
974729124 4:65838353-65838375 GGAGAGTGGCATGCCTGGAGAGG + Intergenic
976054740 4:81050322-81050344 GGAGAACAGATTGGCTGTAAGGG - Intronic
976227996 4:82811924-82811946 GGAGAGGAGTTTGGTTAGAGCGG - Intergenic
977151953 4:93523635-93523657 TGAGTGTAGGTTGGCAGGAGGGG + Intronic
977593400 4:98851414-98851436 GGAGAACAGAATGGCTGGTGTGG + Intergenic
977875167 4:102141078-102141100 GGACAGTACATTGTCTGTAGTGG + Intergenic
981614540 4:146633429-146633451 GGAAAGTAGACTGGGAGGAGGGG - Intergenic
981714081 4:147735483-147735505 AGAGACTAGTTTGGCTGGAATGG + Intronic
981805554 4:148711196-148711218 GGAGTGTTGTTTGGCGGGAGGGG + Intergenic
983498561 4:168473348-168473370 AGAGAGCAGATTGGATGGGGAGG + Intronic
990274360 5:54179599-54179621 GGAGAGGAGATTGACTGGGATGG + Intronic
990400367 5:55431414-55431436 TGAGAATAGTTTGGCTGGTGGGG - Intronic
990466444 5:56075952-56075974 GGTGAAGAGATTGGCTGGGGAGG + Intergenic
990601067 5:57359155-57359177 GGAGAGTAGGTTGGGTGTGGTGG + Intergenic
992529989 5:77644634-77644656 GAAGCGTAGAGTCGCTGGAGCGG - Intergenic
992638605 5:78749125-78749147 GGAGAGTGGATTGACTGGCAGGG + Intronic
995333059 5:110967054-110967076 GAAGATTTGATTGGCTGGAAGGG - Intergenic
996022333 5:118605049-118605071 GCAGAGTATATTGGCTGAACTGG + Intergenic
996313200 5:122130333-122130355 GGAGGGAAGATTGGCTGGAAAGG - Intronic
997932470 5:138083838-138083860 GGAGGGAAGAAGGGCTGGAGGGG + Intergenic
998138757 5:139688329-139688351 GGAGTAGAGAATGGCTGGAGAGG + Intergenic
999361956 5:150992855-150992877 GGAGATCAGAGTGACTGGAGTGG + Intergenic
999545122 5:152620315-152620337 GGAGAGTGGATTGACTGGAAGGG + Intergenic
1001551813 5:172608251-172608273 GGAGGGAAGATTGACTGGGGAGG + Intergenic
1001715898 5:173815829-173815851 TGAGAGCAGAATGGCAGGAGTGG + Intergenic
1003255491 6:4471506-4471528 GGTGAGTAGTTTGGCGGGAAGGG - Intergenic
1003997004 6:11551819-11551841 GGAGGGTAGAGAGGCAGGAGAGG + Intronic
1004078889 6:12371122-12371144 GGAGATTATATTGGGTGGCGAGG - Intergenic
1006284407 6:33081653-33081675 GGAGAGCAGGTTGGCCGCAGCGG + Intronic
1007664001 6:43503836-43503858 GCAGAGTTGACTGGCTTGAGAGG - Intronic
1008408757 6:51148316-51148338 GGACAGCAAATGGGCTGGAGAGG + Intergenic
1008655273 6:53605733-53605755 GGAGGCTAGTATGGCTGGAGTGG + Intronic
1009526850 6:64758236-64758258 GGAGAGTATAGTGGCTAGTGAGG - Intronic
1012549683 6:100455462-100455484 GGAGAATAGGTTGGCTGAAAGGG - Intronic
1012673357 6:102085275-102085297 GAAGAGGAGATTGGGTGGGGGGG - Intergenic
1013258962 6:108418342-108418364 GCAGAGTTGAGTGGCTGCAGTGG + Intronic
1013368931 6:109454226-109454248 GCAGAGATGAGTGGCTGGAGAGG + Exonic
1014598772 6:123381481-123381503 GGAGAGAAAATTGGAAGGAGGGG - Intronic
1016224666 6:141720962-141720984 GCAGAGTAGATTGGTGGGAGAGG - Intergenic
1016780589 6:147953321-147953343 TGAGAGTCGAATGGCTGAAGTGG - Intergenic
1017099249 6:150832965-150832987 GGAAAGTACAATGGCTGGCGTGG - Intronic
1018636991 6:165871461-165871483 GGAGAGAGGATTGCATGGAGGGG + Intronic
1018837898 6:167498802-167498824 GGAGGGTGGATGGGCTGCAGGGG - Intergenic
1019046389 6:169151446-169151468 GGAGAGTAGAGTGGCCTCAGTGG - Intergenic
1019309957 7:355139-355161 GGAGAGGACATGGGCTGCAGAGG - Intergenic
1019632660 7:2058154-2058176 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632745 7:2058477-2058499 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632763 7:2058554-2058576 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632812 7:2058749-2058771 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632830 7:2058826-2058848 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632880 7:2059016-2059038 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632888 7:2059052-2059074 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632896 7:2059086-2059108 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632921 7:2059199-2059221 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632929 7:2059233-2059255 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1019632937 7:2059267-2059289 GGAGAGAAGCAGGGCTGGAGAGG + Intronic
1020765162 7:12310751-12310773 GGAAGGTAGATTGGGTGCAGTGG + Intergenic
1020769670 7:12373418-12373440 GGAGAGCAGCTTGACTGGAGTGG - Intronic
1021731945 7:23604350-23604372 AGAGAGAAGACTGGCTGGATTGG + Intronic
1021870066 7:24996913-24996935 GGATACAAGAGTGGCTGGAGAGG - Intergenic
1022306985 7:29155749-29155771 GGAGGGTAGGCTGGCTGGAGGGG + Intronic
1022981781 7:35611153-35611175 GGAGGGTAGGGTGGCTGGAGAGG + Intergenic
1023325091 7:39045706-39045728 GGAGTGGAGACTGGCTGTAGAGG - Intronic
1023689636 7:42772759-42772781 GGAGAGCAGATAGCCAGGAGGGG + Intergenic
1024942885 7:54780674-54780696 GGAGCCCAGATTGTCTGGAGCGG + Intergenic
1027697452 7:81430005-81430027 TGAGAGTAGGCTGGGTGGAGTGG + Intergenic
1030171505 7:106607354-106607376 GGAGAGTAGAATGGGGTGAGAGG - Intergenic
1031959911 7:127979488-127979510 GGTGAGTAGTTTGGCAGGAAGGG + Intronic
1032209613 7:129901484-129901506 AGGCAGTAGACTGGCTGGAGGGG + Intronic
1032237679 7:130139604-130139626 GGTGAGCAGATTGGCTGGGTTGG - Intergenic
1032282732 7:130517599-130517621 GGTGAGTAGTTTGTCTGTAGAGG + Intronic
1032504112 7:132422988-132423010 GGAGAGCAGAATGGATGGTGTGG + Intronic
1033464200 7:141576441-141576463 GGTGAGTAGTTTGGCAGGAAGGG + Intronic
1034262919 7:149767946-149767968 GGAGAGCAGCTTGGCTGAAGTGG - Intronic
1034336061 7:150324265-150324287 TGAGAGCAGAGGGGCTGGAGAGG + Intronic
1035039353 7:155916331-155916353 GGAGAGCAGACGGGATGGAGTGG - Intergenic
1035416862 7:158696387-158696409 GGAGAGGACATAGGCTGCAGAGG + Intronic
1036503262 8:9332810-9332832 AGAGAGTAGATTTAGTGGAGGGG - Intergenic
1037475251 8:19250957-19250979 GGAGAGTAAAGTTGATGGAGGGG - Intergenic
1038609076 8:29042697-29042719 GGGTAGGAGATTGGCTGGACAGG + Intronic
1039307377 8:36277462-36277484 GGAGAGGAGATTGACTGCAAAGG - Intergenic
1039395467 8:37221875-37221897 AGAAAGTAGAATGGCTGGACTGG + Intergenic
1040073253 8:43205157-43205179 AGAGAGGAGTTTGGCTGGGGTGG - Intergenic
1040562197 8:48532935-48532957 GGCGAGAAGCCTGGCTGGAGCGG - Intergenic
1042724721 8:71861021-71861043 GGAGAGCAGAATGGATGTAGAGG + Intronic
1042993544 8:74667684-74667706 GGAGAGCAGATTGTCTGTTGGGG - Intronic
1044182718 8:89215990-89216012 GGAGGTTAGTGTGGCTGGAGTGG + Intergenic
1044340521 8:91041128-91041150 CGAGAGTAAATGGGATGGAGGGG + Intergenic
1047148427 8:122232385-122232407 GGTGAGTAGTTTGGCAGGAAGGG - Intergenic
1048394275 8:133998924-133998946 GAAGAGTAGGTTTGCAGGAGTGG - Intergenic
1048643254 8:136388170-136388192 GGAGTGTGGAGGGGCTGGAGGGG - Intergenic
1050094601 9:2051081-2051103 GGAGATGAAATTGTCTGGAGAGG + Intronic
1051421647 9:16894735-16894757 GGAGAGTCGCTGGGTTGGAGAGG - Intergenic
1052051033 9:23850156-23850178 GGAGAGTTGAGTGGTTGGAGGGG + Intergenic
1052820006 9:33130924-33130946 GGAGAGTGGAGAGGCAGGAGTGG + Intronic
1053487501 9:38471057-38471079 GGAGAGTAGACTTGTTGGAGGGG - Intergenic
1056499850 9:87198003-87198025 AGAGAGCAGATTGTGTGGAGAGG - Intergenic
1056741267 9:89257478-89257500 GGAGAGTAAATGGGTGGGAGAGG - Intergenic
1057068970 9:92079607-92079629 GGAGAGCAGATTGCCTGGGGTGG - Intronic
1058750974 9:108037867-108037889 GGAGATGAGAGTGACTGGAGTGG + Intergenic
1059480910 9:114588748-114588770 GGAGAATGGATTGACTGGAGGGG - Intronic
1060189772 9:121584744-121584766 GGGGCGCAGAGTGGCTGGAGGGG + Intronic
1062048042 9:134433416-134433438 GGCGAGGAGACTGGCTGGAGCGG + Intronic
1185772218 X:2773402-2773424 GGAGAGGAGAAAGGTTGGAGGGG + Intronic
1186552098 X:10517026-10517048 GGAGAGTTGGGTGGCTGAAGGGG + Intronic
1187253459 X:17620852-17620874 AGAGAGTATATTGGGTGGGGAGG + Intronic
1188580418 X:31705160-31705182 GGAGAGTAGATTGGAGGGGAGGG + Intronic
1192539443 X:71955737-71955759 GGAGGGTAGGATGGCTGTAGAGG + Intergenic
1192542844 X:71989803-71989825 GGAGAGTAGATCATCTGGATGGG + Intergenic
1194819776 X:98491209-98491231 GGAGAGTGGCATGCCTGGAGAGG + Intergenic
1195683743 X:107567615-107567637 GCATAGTTGCTTGGCTGGAGAGG + Intronic
1196486962 X:116223083-116223105 GGAGTCTAGAATGGCAGGAGTGG + Intergenic
1198082508 X:133252685-133252707 GGAGACTTGATTGGCAGGTGTGG - Intergenic
1198301201 X:135335451-135335473 GGAGACTAAATTGGCTAGAGGGG - Intronic
1199104068 X:143840975-143840997 AGACAGTGGATTGGGTGGAGTGG - Intergenic
1199767897 X:150953962-150953984 AGAGAGGAGACTGGCTGGGGAGG - Intergenic