ID: 1081796658

View in Genome Browser
Species Human (GRCh38)
Location 11:45825208-45825230
Sequence CCAAATATACAAACGGACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 5, 3: 48, 4: 360}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081796653_1081796658 -2 Left 1081796653 11:45825187-45825209 CCCTCTCTGCACACCGAGAGACC 0: 1
1: 0
2: 1
3: 6
4: 149
Right 1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG 0: 1
1: 0
2: 5
3: 48
4: 360
1081796652_1081796658 1 Left 1081796652 11:45825184-45825206 CCTCCCTCTCTGCACACCGAGAG 0: 1
1: 0
2: 1
3: 13
4: 204
Right 1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG 0: 1
1: 0
2: 5
3: 48
4: 360
1081796654_1081796658 -3 Left 1081796654 11:45825188-45825210 CCTCTCTGCACACCGAGAGACCA 0: 1
1: 0
2: 1
3: 14
4: 112
Right 1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG 0: 1
1: 0
2: 5
3: 48
4: 360
1081796650_1081796658 20 Left 1081796650 11:45825165-45825187 CCCAAATCACATAGAAAGGCCTC 0: 1
1: 0
2: 3
3: 28
4: 229
Right 1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG 0: 1
1: 0
2: 5
3: 48
4: 360
1081796651_1081796658 19 Left 1081796651 11:45825166-45825188 CCAAATCACATAGAAAGGCCTCC 0: 1
1: 0
2: 0
3: 11
4: 124
Right 1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG 0: 1
1: 0
2: 5
3: 48
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081796658 Original CRISPR CCAAATATACAAACGGACAA TGG Intergenic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
903863947 1:26384151-26384173 CCAAATTTAAAAATGGGCAAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
908244285 1:62215393-62215415 CTCAATATACAAACATACAATGG - Intergenic
909584971 1:77279927-77279949 CCAAATAAACAAAGGGCCAAGGG + Intergenic
910367339 1:86480349-86480371 CCAAATAGAAAAATAGACAAAGG + Intronic
910990404 1:93049924-93049946 CCCAATTTAAAAATGGACAAAGG - Intergenic
911156220 1:94639859-94639881 CCAAATTTTTAAATGGACAAAGG + Intergenic
911846236 1:102754767-102754789 CCAAATAGAAAAATGCACAATGG + Intergenic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
916429825 1:164717053-164717075 CCAAATACACGAACGCAGAATGG + Intronic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918748588 1:188240675-188240697 TCAAATATGAAAATGGACAAAGG + Intergenic
920552240 1:206872294-206872316 CTGAATATACAAACAGACAGTGG + Intergenic
920598279 1:207295179-207295201 CCCAATTTAAAAATGGACAAAGG - Intergenic
920716637 1:208346226-208346248 CCAAATATACACACTGTCAATGG - Intergenic
920906100 1:210170422-210170444 ACAATTATACAAAAGGAAAAAGG - Intronic
921745549 1:218736455-218736477 CCAAATAAACAAACTCAAAAAGG - Intergenic
922205820 1:223445282-223445304 CCCAATTTAAAAATGGACAAAGG + Intergenic
922319477 1:224473159-224473181 TCAAATTTAAAAACGTACAATGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922374455 1:224946770-224946792 CCAAATATACAAACAAAACAAGG - Intronic
924049035 1:240061787-240061809 CAGAATAAACAAACAGACAATGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924700618 1:246448474-246448496 CTAAATAAACAAATGGTCAAAGG + Intronic
1062763111 10:42504-42526 CCAAATTGAAAAATGGACAAGGG - Intergenic
1063057266 10:2519441-2519463 CCTAATATCCAAACATACAAGGG + Intergenic
1063263494 10:4417704-4417726 CAAAATATACAAACATGCAAAGG - Intergenic
1065549802 10:26859725-26859747 CCAAATACAGAAACGAACAGAGG - Intronic
1066674052 10:37869864-37869886 CCCAATTTAAAAATGGACAAAGG - Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1067521709 10:47012713-47012735 CCAAGGAAACAAAGGGACAAAGG + Intergenic
1068496140 10:57787212-57787234 CCCAATATCCAAACCGACCAAGG + Intergenic
1068575545 10:58680258-58680280 CCAAATATACAAACATATACAGG - Intronic
1068675170 10:59763040-59763062 CTGAATATACAAACAGACAGTGG - Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1069647773 10:70016737-70016759 CCCAATTCACAAATGGACAAAGG + Intergenic
1069830800 10:71281318-71281340 CAAAATATAAAAATGGAAAAAGG + Intronic
1071058744 10:81544579-81544601 CCCAATTTAGAAATGGACAAAGG + Intergenic
1071879672 10:89882814-89882836 TCAAATCTAAAAACAGACAATGG - Intergenic
1072106704 10:92281131-92281153 CCCAATTTAAAGACGGACAAAGG + Intronic
1072106712 10:92281209-92281231 CCCAATTTAAAAACAGACAAAGG - Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1074729433 10:116353541-116353563 CCCAATTTAAAAATGGACAAAGG + Intronic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1075145542 10:119879849-119879871 CTGCATATACAAACAGACAATGG - Intronic
1075154076 10:119959477-119959499 CTAAATAAACAAACAAACAAAGG - Intergenic
1076079063 10:127561583-127561605 ATGAATATACAAACGGGCAATGG + Intergenic
1076436518 10:130448883-130448905 CCCAATTTAAAAATGGACAAAGG - Intergenic
1078238049 11:9504324-9504346 CCAATTTTAAAAACGGGCAAAGG - Intronic
1078524962 11:12093279-12093301 ACAAATAGACAAACAGACATTGG + Intergenic
1079415086 11:20226831-20226853 CCAAATTTACAAATAGACTAGGG - Intergenic
1079813858 11:25030100-25030122 ACAAATATGCAAACACACAAAGG - Intronic
1080237363 11:30086618-30086640 AAAAATATACAAACAGACAATGG - Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081373177 11:42329007-42329029 GCAAATAAACAAAATGACAATGG + Intergenic
1081796658 11:45825208-45825230 CCAAATATACAAACGGACAATGG + Intergenic
1082282733 11:50287439-50287461 CCATATTTAAAAACTGACAAAGG + Intergenic
1082306228 11:50579626-50579648 CCAAATATACATTCGCAGAATGG + Intergenic
1084467373 11:69333925-69333947 GCAAATGGACAAATGGACAAAGG - Intronic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1088167341 11:106954761-106954783 ACAAAAATACAAAAAGACAAGGG - Intronic
1088834354 11:113565362-113565384 ACAAACAAACAAACAGACAAAGG - Intergenic
1089851684 11:121502710-121502732 CCCAATTTAAAAACGGACAAAGG - Intronic
1090340211 11:126011546-126011568 CCCAATAGAAAAACTGACAAAGG - Intronic
1090567338 11:128008855-128008877 ACAAAGATAAAAAAGGACAAAGG + Intergenic
1090866827 11:130708579-130708601 CCCAATTAAAAAACGGACAAAGG + Intronic
1092624013 12:10305755-10305777 CCAAATATTCCAAGGGACATAGG + Intergenic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094375736 12:29785282-29785304 CCAAATAAACAAAGTGAAAATGG - Intergenic
1094632987 12:32195961-32195983 CCCAATTTAAAAACGGACAAAGG + Intronic
1094776700 12:33737856-33737878 ACAAACATACAAATGTACAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1094813005 12:34160178-34160200 CCAAATTCACAAATGGACAAGGG - Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095121727 12:38426833-38426855 ACGAATATACAAAAGGACAATGG - Intergenic
1095406182 12:41869857-41869879 CCCAATTTAAAAATGGACAAAGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096392770 12:51242136-51242158 CCAAAGATACAAACAGGAAAGGG - Intronic
1096908147 12:54955302-54955324 CCAATTAAAAAAATGGACAAAGG + Intronic
1097181539 12:57174763-57174785 CCAAACAAACAAACAGGCAAGGG + Intronic
1097873430 12:64621319-64621341 CCTAATAGACAAATGGGCAAAGG - Intronic
1097950106 12:65418321-65418343 CCCAATTTAAAAACGGGCAAAGG - Intronic
1099460366 12:82913797-82913819 CCACATATATCAAGGGACAACGG - Intronic
1100107844 12:91198857-91198879 GAAAATATACAAATGGCCAATGG - Intergenic
1100322822 12:93513019-93513041 CCAGATTTACAAAGGGATAATGG - Exonic
1102658986 12:114508613-114508635 CCAGAAACACAAAAGGACAATGG - Intergenic
1103430484 12:120880881-120880903 CCAAAAAAAAAAATGGACAAAGG + Intronic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104393545 12:128411873-128411895 ACAAATATAGAAAGGGACATGGG - Intronic
1105906321 13:24813455-24813477 CCAATTACAAAAATGGACAAAGG - Intronic
1106000278 13:25716150-25716172 CCCAATTTAAAAACGGGCAAAGG - Intronic
1106105888 13:26733260-26733282 CTAAATATACAAGTAGACAATGG + Intergenic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1106881627 13:34138279-34138301 CTGAATATACAAACTGACATTGG + Intergenic
1107103421 13:36618446-36618468 CCAAATATACAAAAAAAGAAAGG - Intergenic
1107705830 13:43103786-43103808 CAAAATATACAAAGGAAAAAAGG - Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1108390712 13:49945043-49945065 CCCAATTTAAAAATGGACAAAGG - Intergenic
1108463904 13:50695273-50695295 GAAAATACACAAATGGACAATGG + Intronic
1108878918 13:55084933-55084955 TCAAATCTAAAAACGTACAATGG - Intergenic
1109100579 13:58180016-58180038 CCAAATATTCAAAGGCACATAGG + Intergenic
1109532544 13:63669521-63669543 CCCAATTTAAAAATGGACAAAGG + Intergenic
1109550920 13:63898877-63898899 CAAAATTTAAAAATGGACAAAGG + Intergenic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1110661716 13:78065515-78065537 CCGAATATGCAAACAGACAGTGG + Intergenic
1110974300 13:81809243-81809265 CCAAATATTCAAAAGGAATAAGG - Intergenic
1111534701 13:89587778-89587800 CAAAATAAACTAAAGGACAAAGG - Intergenic
1112332654 13:98488502-98488524 CCCAATAGAAAAATGGACAAAGG - Intronic
1113571979 13:111364522-111364544 CCAAATTTAAAAATTGACAAAGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115829421 14:37318458-37318480 GCAAATTAACAAACTGACAAGGG - Intronic
1116233162 14:42243744-42243766 TCAAATAAACAAACAAACAATGG + Intergenic
1117793955 14:59372131-59372153 CCAAATATACAAATAGGCAGTGG - Intergenic
1118120335 14:62832939-62832961 CCAAATTTAAAAATGGGCAAAGG - Intronic
1118391765 14:65301908-65301930 CCAAATATGCAAATGGACAATGG + Intergenic
1119014059 14:71031192-71031214 GCAAATATGCAAATGGAGAAGGG + Intronic
1120374588 14:83686446-83686468 CCAGATTTAAAAATGGACAAAGG + Intergenic
1121434453 14:93909985-93910007 CCCAAAGTACAAACAGACAATGG - Intergenic
1121759624 14:96434211-96434233 CCAGATATTCAAAAGGACATGGG + Intronic
1122294900 14:100699917-100699939 CTAAATATCCAAAGGGACAGTGG - Intergenic
1124460046 15:29881268-29881290 CCCAATTTAAAAACGGGCAAAGG - Intronic
1125363563 15:38889746-38889768 TCAAATATTCAAACTGACATAGG - Intergenic
1125446494 15:39763347-39763369 ACAAATATACATACAAACAAAGG + Intronic
1126338378 15:47612199-47612221 CCAAACATGCAAAGGGACAATGG - Intronic
1126378368 15:48019640-48019662 CCAAATTTTAAAATGGACAAAGG + Intergenic
1126961804 15:54004783-54004805 GAATATATACAAACGGAAAATGG - Intergenic
1127193301 15:56556152-56556174 CCCAATTTAAAAACGGGCAAAGG - Intergenic
1129958082 15:79657577-79657599 CTGTATATACAAACAGACAATGG + Intergenic
1130026346 15:80273892-80273914 CCCAATTTAAAAATGGACAAAGG + Intergenic
1131004252 15:88963730-88963752 TCAAATAGACAAAAGAACAAAGG - Intergenic
1131828421 15:96338507-96338529 GCAAATATACAAACAGATATAGG - Exonic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1133109651 16:3540143-3540165 CCTAATTTACAAAGGGAAAAAGG - Intronic
1134274369 16:12762632-12762654 GCAAATCTACACACGGACAGTGG + Intronic
1135242720 16:20823204-20823226 CCCAATTTAAAAATGGACAAAGG - Intronic
1136492949 16:30622433-30622455 CCAAATCTAGAAAGGGCCAAGGG - Intronic
1137081421 16:36063075-36063097 CCAAATATCCACATGCACAAAGG - Intergenic
1137505358 16:49049577-49049599 TTAAACATACAAACTGACAAAGG - Intergenic
1137639638 16:50017256-50017278 CCCAATTTAAAAATGGACAAAGG - Intergenic
1137851263 16:51747152-51747174 AAAAATAAACAAACAGACAAAGG + Intergenic
1138572086 16:57881794-57881816 ACAAATATACAAACAGTAAATGG + Intergenic
1138636589 16:58344032-58344054 CCAGATTTAAAAATGGACAAAGG - Intronic
1138704233 16:58898018-58898040 ACAAATATACAAACATACATGGG + Intergenic
1138947092 16:61864597-61864619 CCAAATATCCAAACCTCCAAGGG + Intronic
1140819330 16:78648465-78648487 CCAAAGATACACATGGACAATGG + Intronic
1141203894 16:81918021-81918043 CCCAATTTAAAAATGGACAAAGG - Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144095388 17:11895725-11895747 CAAATTATACAAATGGAGAATGG - Intronic
1144478911 17:15612843-15612865 CCAAAAATAAAAACAGAAAATGG + Intronic
1145185797 17:20793028-20793050 ACAAATAGAAAAATGGACAAAGG - Intergenic
1145369853 17:22299251-22299273 CCAAACACACACACGCACAAGGG - Intergenic
1146287546 17:31584401-31584423 CCAAATACCCAAAAGGAGAAAGG - Intergenic
1148324516 17:46775473-46775495 CAAAATAAACAAATGGAAAAAGG - Intronic
1148357168 17:46983173-46983195 CCAAATATGCAAATAGACAATGG - Intronic
1148411326 17:47469825-47469847 ACAAATAGAAAAATGGACAAAGG + Intergenic
1150386888 17:64768723-64768745 CCCAATACACAAACAGGCAAAGG + Intergenic
1150563904 17:66321081-66321103 CAAAATATACAAAATAACAATGG + Intronic
1151048573 17:70949561-70949583 CCAAATAAACAAAAGTACACAGG + Intergenic
1152956020 18:42835-42857 CCAAATTGAAAAATGGACAAGGG - Intergenic
1154147505 18:11878563-11878585 CCAAATAAACAAACTAAAAAAGG - Intronic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157188217 18:45558718-45558740 CCATAGATACCAAGGGACAAAGG + Intronic
1158148251 18:54340974-54340996 CCAAATACATAAAGGGAAAATGG + Intronic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159159688 18:64627843-64627865 CCAAACAAACAAACAAACAAAGG - Intergenic
1159340779 18:67129904-67129926 GCAAACATAAAAATGGACAATGG - Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160571575 18:79820948-79820970 CCAAATCTAAAAATGGGCAAAGG - Intergenic
1165774122 19:38395053-38395075 CCAAATATACACTCTGAAAATGG - Intronic
1166154502 19:40900814-40900836 CCAAACAAACAAACGGACTGGGG - Intergenic
1166173611 19:41049776-41049798 CCAAACAAACAAACGGACTGGGG + Intergenic
1167700458 19:51041147-51041169 CCAAATATACAACTGGTGAATGG + Intergenic
1168463305 19:56580558-56580580 CCATAACTACAAAAGGACAAGGG - Exonic
1168483583 19:56741482-56741504 CCAAATATACATACAGGCAATGG - Intergenic
1168489214 19:56794036-56794058 CAAAATATACATATGGAAAAGGG - Intronic
925244441 2:2368102-2368124 ACAAATAAACAAACAAACAAGGG + Intergenic
926481867 2:13409090-13409112 CCAATGATACAAACTGACAGAGG + Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928436622 2:31258607-31258629 CCAGAGATACAAACAGATAAAGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
930144405 2:47986570-47986592 CCCAATTTAGAAATGGACAAAGG - Intergenic
930961094 2:57262642-57262664 TGAAATATACCAACAGACAAAGG + Intergenic
932273546 2:70433663-70433685 CCCAATTTAAAAATGGACAAAGG - Intergenic
932555506 2:72821171-72821193 CCCAATTTAAAAACGGGCAAAGG + Intronic
932561646 2:72877446-72877468 CCCAATATAAAAACAGGCAAAGG - Intergenic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932907358 2:75768325-75768347 TGAAATATACAACCAGACAATGG + Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933207641 2:79527181-79527203 CTAAATTTAAAAATGGACAAAGG + Intronic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935515580 2:104033624-104033646 GCAAATAAACAAACAAACAAAGG + Intergenic
935540932 2:104348026-104348048 TCCAATTTAAAAACGGACAAAGG + Intergenic
935677981 2:105612347-105612369 CCGAATAAACAAACCCACAAAGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
937557876 2:123181292-123181314 CCAGATATTCAAAAGGACATGGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
937934074 2:127228529-127228551 CAAATTATACCACCGGACAAAGG - Intergenic
938058926 2:128237295-128237317 ATGAATATACAAACAGACAATGG + Intronic
938816788 2:134912900-134912922 TCAAACAAACAAACAGACAAAGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
941172281 2:162154000-162154022 TCAAATAGACAAATAGACAATGG - Intergenic
941779508 2:169428733-169428755 CCAAATTTAAAAATGGGCAAAGG + Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
942402505 2:175618059-175618081 CCAATTTTAAAAATGGACAAAGG - Intergenic
943338604 2:186649540-186649562 CCAAACATACATACTGCCAAAGG - Intronic
943719758 2:191191433-191191455 CTAGATATACAAAAGGACAATGG - Intergenic
943766734 2:191671027-191671049 GCATATATACAAAGGGAAAATGG + Intergenic
944123214 2:196264009-196264031 CCAACAATACAAACAGAAAAAGG - Intronic
944208117 2:197178570-197178592 CCAAATAAAGAAATGGGCAAAGG + Intronic
944213777 2:197233477-197233499 CAAAATTAACAAAGGGACAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
946502026 2:220259654-220259676 CCAAATACACAAACATGCAAAGG - Intergenic
947829878 2:233131698-233131720 TCAAATAAACAAACAAACAAAGG + Intronic
947993922 2:234511382-234511404 CCAAGTTTAAAAAGGGACAAGGG - Intergenic
1169215146 20:3789232-3789254 TCAAATAAACAAAAGGAGAATGG - Intronic
1169702112 20:8458304-8458326 TGAAATATACAAACGGACAATGG - Intronic
1170022073 20:11847486-11847508 CCATAAATACATACGGCCAATGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171018548 20:21563497-21563519 CCAAAAATACAAACAGGCAGTGG + Intergenic
1171793119 20:29546777-29546799 CCAAAGATACACACGCACACGGG - Intergenic
1171846796 20:30282311-30282333 CCAAAGACACACACGCACAAGGG - Intergenic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1174245637 20:49177718-49177740 CTAAATATAAGAACGGAAAAAGG + Intronic
1174410719 20:50333272-50333294 CCAAATTCTCAACCGGACAAGGG + Intergenic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1177378471 21:20305363-20305385 CTAGATAAACAAATGGACAATGG - Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1179717139 21:43294726-43294748 CCCAATAGAAAAATGGACAAAGG - Intergenic
1181783442 22:25208958-25208980 CTAAATAAACAAACAAACAAAGG - Intergenic
1185412298 22:50689668-50689690 CCCAATTTAAAAATGGACAAAGG - Intergenic
949921343 3:9005109-9005131 CCAAATTTAAAAATGGGCAAAGG + Intronic
949933634 3:9099864-9099886 CCAAATACTCAAATGCACAAAGG + Intronic
950052023 3:9999057-9999079 CCCAATTTAAAAACGGGCAAAGG - Intronic
950519578 3:13489080-13489102 CCAATTTTAAAAATGGACAAAGG - Intronic
950753734 3:15154652-15154674 ACAAAAATACAAATGAACAAGGG + Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
951954239 3:28237227-28237249 CCCAATATAAAAATGGGCAAAGG - Intergenic
952105915 3:30069313-30069335 CCAAATAATCAAACTGCCAAGGG - Intergenic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953204240 3:40807673-40807695 CCCAATTTAAAAAGGGACAAAGG - Intergenic
955420800 3:58735205-58735227 CCAAATTAACAAAGGGAGAAAGG - Intronic
955672626 3:61417919-61417941 CCAAAAGTACAAAAGGACATGGG + Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956335019 3:68154082-68154104 CCAAATAAGCAATCAGACAATGG - Intronic
956677238 3:71747449-71747471 CCAATTTTAAAAATGGACAAAGG - Intronic
957108365 3:75920786-75920808 ACAAAGATAAAAAAGGACAAAGG - Intronic
959178872 3:102953510-102953532 GACAATATACAAATGGACAATGG + Intergenic
960126880 3:114008751-114008773 TCAAATAGAAAAATGGACAAAGG + Intronic
961142664 3:124568168-124568190 CTAAATTTAAAAATGGACAAAGG + Intronic
963725974 3:148922295-148922317 CCCAATGTAAAAATGGACAAAGG + Intergenic
964178407 3:153854661-153854683 ACAAATAAACAAACAAACAAAGG - Intergenic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
968358322 3:198125406-198125428 CCAAATTGAAAAATGGACAAGGG + Intergenic
969083923 4:4641346-4641368 CCAAAGATACAAAAGGGAAAAGG - Intergenic
970385981 4:15557023-15557045 ACAAATATACAGACTGAAAAAGG - Intronic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
971977061 4:33704126-33704148 CCAAATATACAAACCAATTAAGG - Intergenic
972663269 4:41138520-41138542 CCCAATATAAAAATGGGCAAAGG + Intronic
974178010 4:58348907-58348929 CCAATTATAAAAAAAGACAATGG + Intergenic
974580501 4:63794359-63794381 CCAGATATACAAACGAGGAATGG + Intergenic
974623801 4:64396476-64396498 CCACATTTAAAAATGGACAAAGG - Intronic
975400719 4:73935513-73935535 ACATATATACACACAGACAAAGG - Intergenic
975575931 4:75862468-75862490 CCCAATTTAAAAATGGACAAAGG + Intronic
975609202 4:76187351-76187373 CCAGATAAGCAAATGGACAAAGG + Intronic
975749151 4:77505152-77505174 CCAGATATACAGATAGACAAAGG - Intergenic
975767564 4:77684845-77684867 CCCAATTTAAAAACAGACAAAGG + Intergenic
976306744 4:83567604-83567626 CCAAACATTTAAACTGACAAGGG - Intronic
976650679 4:87430757-87430779 CCCAATTTAAAAACGGGCAAAGG - Intronic
976780097 4:88749193-88749215 CCAAATATAAAGAAGGATAATGG - Intronic
977763467 4:100769852-100769874 CCACATATACAAACACACAAAGG - Intronic
979563388 4:122125614-122125636 ACAAATATACAAATGGACATAGG - Intergenic
983655246 4:170076541-170076563 CCCAATTTAAAAATGGACAAAGG - Intronic
984546372 4:181109042-181109064 CCAAATACACATAGGGAAAAGGG + Intergenic
984798499 4:183689494-183689516 CCAAATAATCACACAGACAACGG - Intronic
986646397 5:9920751-9920773 ATAAACATACAAACGGGCAATGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987682427 5:21154861-21154883 CCAAAAACACAAACAGACACTGG + Intergenic
987819535 5:22945028-22945050 CCAAATCTACATACAGTCAAAGG - Intergenic
987921970 5:24295156-24295178 ACAAATAAACAAACAAACAAGGG - Intergenic
987945352 5:24600958-24600980 CCACATATACAAACTGCCTAGGG - Intronic
990686569 5:58309560-58309582 CCAAATAAACAAACAGAAAAAGG - Intergenic
991393385 5:66174869-66174891 TCAAATATACAAAAGCAAAAGGG - Intronic
991931973 5:71762281-71762303 CCAAATTTAAAGACGGGCAAAGG - Intergenic
992843288 5:80717800-80717822 CCAAATTTAAAAATGGGCAAAGG - Intronic
995571049 5:113482581-113482603 CCCAATGTAAAAATGGACAAAGG - Intronic
995691203 5:114828066-114828088 CCTAATTTAAAAATGGACAAAGG + Intergenic
996296125 5:121919274-121919296 CCAAAGGTACAAAGGTACAAAGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997810061 5:136958281-136958303 CTAGATATACAAACAGAGAATGG - Intergenic
998533411 5:142906553-142906575 CCATAAATCCAAACTGACAATGG - Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999817114 5:155188198-155188220 CAAGATATACAAATGGCCAAAGG - Intergenic
999912236 5:156215498-156215520 CCTGATTTACAAATGGACAAAGG + Intronic
1000508890 5:162157261-162157283 CCACATATCCCAAAGGACAAAGG - Intergenic
1000645367 5:163754931-163754953 CCAATTATTGAAACTGACAATGG + Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005053257 6:21705319-21705341 ACAAATATAAAAATGTACAAAGG - Intergenic
1005231826 6:23710507-23710529 GCAACTATACAAAAGGACTAAGG + Intergenic
1006821147 6:36896445-36896467 CCAAATAAAAAAATAGACAAAGG - Intronic
1008431609 6:51424514-51424536 CAAGATATACAAATGGCCAAAGG + Intergenic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1009903650 6:69841269-69841291 CCAAATTTACAAATGGGCAATGG - Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011741660 6:90367316-90367338 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1012761750 6:103310733-103310755 CCAAATATTCAAAAGGACTTGGG - Intergenic
1012775274 6:103488468-103488490 CCTAATATCCAAAAGGACAGAGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1016208111 6:141495212-141495234 CCATATAAACAAACATACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1020150140 7:5675650-5675672 ACAAACAAACAAACGAACAAAGG + Intronic
1020463885 7:8454484-8454506 TCAAATTTACAAATGAACAAAGG - Intronic
1021766372 7:23953339-23953361 CCAAATAAACAAAATGAAAAAGG + Intergenic
1023006905 7:35880092-35880114 CCATATTTAAAAACTGACAAAGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024067331 7:45751307-45751329 CCATATTTAAAAACTGACAAAGG + Intergenic
1024499460 7:50088579-50088601 CCAAATTTAAAAACGGGCAAAGG + Intronic
1025284436 7:57650720-57650742 CCAAAGACACACACGCACAAGGG + Intergenic
1027996916 7:85435713-85435735 ACAAATATACCACCTGACAAAGG + Intergenic
1028262654 7:88684734-88684756 ACAAACAAACAAACGAACAAAGG + Intergenic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029055321 7:97734051-97734073 CTAAAGATCCAAACTGACAAAGG + Intronic
1029384597 7:100235109-100235131 TCAAATATGCAAATGGAAAAGGG + Intronic
1031209076 7:118798773-118798795 CTAAATATGCAAACAAACAATGG - Intergenic
1031652243 7:124304813-124304835 ACAAAGATAAAAAAGGACAAAGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1035556242 8:569297-569319 CCGAATATGCAAACAGACAAGGG - Intergenic
1035915277 8:3613624-3613646 CAAAATATACAAACAAAAAATGG + Intronic
1036235031 8:7032234-7032256 ACAAATTTATAAACGGGCAAAGG + Intergenic
1036479269 8:9123812-9123834 CCATATATGCAAACACACAAAGG + Intergenic
1038388985 8:27177197-27177219 CCAAATTTAGAAATGGACACAGG + Intergenic
1038605662 8:29001153-29001175 ACAAACATACAAACATACAAGGG + Intronic
1038968152 8:32599554-32599576 CCAAATAAACAAAGGCTCAATGG - Intronic
1039134678 8:34308150-34308172 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1039396532 8:37230222-37230244 CCCAATATGCAAATGGAAAAGGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040129076 8:43773255-43773277 CCAAATATACAGATAGACACGGG + Intergenic
1040138751 8:43885538-43885560 CAAAATATTAAAACAGACAATGG - Intergenic
1040606417 8:48936507-48936529 CTAAATATACACACTGACCATGG - Intergenic
1041232538 8:55768325-55768347 GCAAATATAAAAACTCACAAAGG + Intronic
1041873113 8:62657942-62657964 CCAAATAACCAAAAAGACAAAGG + Intronic
1042233712 8:66586396-66586418 GAAAACATACAAATGGACAATGG + Intronic
1042359347 8:67864839-67864861 CAAAATATCCAAAAGGAAAATGG + Intergenic
1042727730 8:71895397-71895419 CCATTTAAACAAATGGACAATGG + Intronic
1043346705 8:79306122-79306144 CCAATTTTAAAAATGGACAAAGG - Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1044133423 8:88555699-88555721 CCCAATTTAAAAATGGACAAAGG - Intergenic
1044203500 8:89464088-89464110 GACAATATACAAATGGACAATGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1044634128 8:94305551-94305573 ACAAAGATACAAATGGAGAAGGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1046079225 8:109350776-109350798 CCAATTAAAAAAACAGACAAAGG - Intergenic
1046147835 8:110185117-110185139 TCAAATAAACAACCTGACAACGG - Intergenic
1046151086 8:110227076-110227098 CCCAATTTACAAATGGTCAAAGG - Intergenic
1047096900 8:121635720-121635742 CCAAATATTTAAACACACAAAGG + Intronic
1047830156 8:128620811-128620833 CCACAGATACAGAGGGACAATGG - Intergenic
1048931017 8:139315421-139315443 CCAATTATACATTCAGACAAAGG - Intergenic
1050618939 9:7433038-7433060 CCAAATATAAAACCTGCCAAAGG - Intergenic
1050712331 9:8479550-8479572 CTAAAAATAAAAACTGACAAAGG + Intronic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051010871 9:12412321-12412343 CCCAATTTAAAAATGGACAAAGG + Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051033328 9:12710762-12710784 CCAAATATAGAAGCAGAGAAGGG + Intergenic
1051317196 9:15852402-15852424 CCCAATTTAAAAACGGGCAAAGG - Intronic
1051472318 9:17458725-17458747 CCAAATATACAAACTAGCATTGG + Intronic
1051696415 9:19772537-19772559 CCCAATTTAAAAATGGACAAAGG + Intronic
1052662219 9:31448597-31448619 CCAAGTATAAAAATTGACAATGG + Intergenic
1052807158 9:33023828-33023850 GCATATATACCAACAGACAAAGG + Intronic
1055082332 9:72279588-72279610 CCAAAAGTACAACAGGACAAAGG - Intergenic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1056240082 9:84636656-84636678 CCAAATATCTAAAATGACAATGG - Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1059730568 9:117053039-117053061 CCAAATATAGAAAGAGAAAAAGG + Intronic
1060837218 9:126765402-126765424 CCAAATAGAAAAATGGGCAAAGG + Intergenic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1061841182 9:133359402-133359424 TCCAATATACAAGGGGACAACGG + Intronic
1062742194 9:138181939-138181961 CCAAATTGAAAAATGGACAAGGG + Intergenic
1186234878 X:7497421-7497443 CCAAGTACACCAACAGACAATGG + Intergenic
1186812005 X:13199594-13199616 TCTCATATACAAATGGACAATGG + Intergenic
1186867136 X:13731992-13732014 TCAACTGTACAAAAGGACAAGGG + Intronic
1187802856 X:23083547-23083569 CCCAATTTTAAAACGGACAAAGG + Intergenic
1187841031 X:23488258-23488280 GCAGATATACAAATGGACAATGG + Intergenic
1187910553 X:24107177-24107199 CCAAATTTAAAAATGGGCAAAGG - Intergenic
1188460597 X:30422684-30422706 CCCAATTTAAAAATGGACAAAGG + Intergenic
1190139419 X:47829267-47829289 CTGAATATACAAACAGGCAATGG - Intergenic
1192480983 X:71485671-71485693 CCAAATCTAAAAATGAACAAAGG - Intronic
1192789035 X:74362751-74362773 CCTAATTTAAAAATGGACAAAGG + Intergenic
1193686067 X:84578852-84578874 CCCAATTTAAAAATGGACAAAGG - Intergenic
1193887178 X:86996826-86996848 ACAAACAAACAAACGTACAATGG - Intergenic
1197025134 X:121738820-121738842 CCAAATATTCAAACGGACTTGGG - Intergenic
1198192261 X:134319886-134319908 CCAAATTTAAAAATGGGCAAAGG + Intergenic
1199204143 X:145128089-145128111 TCGAATATACAAACAGACAACGG + Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic