ID: 1081798870

View in Genome Browser
Species Human (GRCh38)
Location 11:45843305-45843327
Sequence AGGGCGCGGATAACTTAAAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081798856_1081798870 24 Left 1081798856 11:45843258-45843280 CCGCCCAGCCGCAAACCGAACCG No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798858_1081798870 20 Left 1081798858 11:45843262-45843284 CCAGCCGCAAACCGAACCGCCGC No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798865_1081798870 -6 Left 1081798865 11:45843288-45843310 CCCAGTCCTACCACTAGAGGGCG No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798855_1081798870 25 Left 1081798855 11:45843257-45843279 CCCGCCCAGCCGCAAACCGAACC No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798859_1081798870 16 Left 1081798859 11:45843266-45843288 CCGCAAACCGAACCGCCGCTGTC No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798857_1081798870 21 Left 1081798857 11:45843261-45843283 CCCAGCCGCAAACCGAACCGCCG No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798860_1081798870 9 Left 1081798860 11:45843273-45843295 CCGAACCGCCGCTGTCCCAGTCC No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798862_1081798870 1 Left 1081798862 11:45843281-45843303 CCGCTGTCCCAGTCCTACCACTA No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798866_1081798870 -7 Left 1081798866 11:45843289-45843311 CCAGTCCTACCACTAGAGGGCGC No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798854_1081798870 26 Left 1081798854 11:45843256-45843278 CCCCGCCCAGCCGCAAACCGAAC No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data
1081798861_1081798870 4 Left 1081798861 11:45843278-45843300 CCGCCGCTGTCCCAGTCCTACCA No data
Right 1081798870 11:45843305-45843327 AGGGCGCGGATAACTTAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081798870 Original CRISPR AGGGCGCGGATAACTTAAAC TGG Intergenic