ID: 1081802652

View in Genome Browser
Species Human (GRCh38)
Location 11:45870380-45870402
Sequence AATTGACTCTGGGGCATTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 119}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081802652_1081802660 19 Left 1081802652 11:45870380-45870402 CCTGGAATGCCCCAGAGTCAATT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1081802660 11:45870422-45870444 TCATTGGTGTGGACTACCCACGG 0: 1
1: 0
2: 0
3: 6
4: 68
1081802652_1081802658 8 Left 1081802652 11:45870380-45870402 CCTGGAATGCCCCAGAGTCAATT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1081802658 11:45870411-45870433 AGCCAAGTGCATCATTGGTGTGG 0: 1
1: 0
2: 0
3: 9
4: 101
1081802652_1081802657 3 Left 1081802652 11:45870380-45870402 CCTGGAATGCCCCAGAGTCAATT 0: 1
1: 0
2: 0
3: 7
4: 119
Right 1081802657 11:45870406-45870428 AAGGCAGCCAAGTGCATCATTGG 0: 1
1: 0
2: 1
3: 6
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081802652 Original CRISPR AATTGACTCTGGGGCATTCC AGG (reversed) Exonic
902361326 1:15943977-15943999 AATTGACTCTCAGGCTTGCCAGG + Intronic
905845102 1:41223148-41223170 AATGGAATCTGGAGCCTTCCAGG + Intronic
908667400 1:66508744-66508766 AACAGACACTGGGGCATTCTGGG + Intergenic
909070420 1:70986633-70986655 AATTGATTCTGGGGATTTCAGGG + Intronic
915662530 1:157416008-157416030 TATTCAGCCTGGGGCATTCCAGG - Intergenic
916558509 1:165912952-165912974 AATCAACTCTGGGGCATTACTGG - Intergenic
923354960 1:233145529-233145551 AAAAGACTCAGGGTCATTCCAGG - Intronic
1067740790 10:48894850-48894872 AATTGTCTCTGTGGCCTTACTGG + Intronic
1072862712 10:99023066-99023088 ACTTGACTCTTGGCCATTTCTGG + Intronic
1073038448 10:100580905-100580927 TATTGACTGTGGGGCCTACCAGG + Intergenic
1075883208 10:125872755-125872777 AACTGACTCTGGGGCATGCAAGG + Intronic
1078470117 11:11579781-11579803 AATTAGCTCTTGAGCATTCCAGG - Intronic
1078555363 11:12320986-12321008 AATTAACTCAGGGTCATTCAAGG - Intronic
1078828159 11:14951472-14951494 AATTGACTTTGGGGGATCCCAGG + Intronic
1079476414 11:20834382-20834404 TATTGAGTTTGGGGTATTCCGGG + Intronic
1079528051 11:21414473-21414495 CATTGACTTGTGGGCATTCCTGG + Intronic
1081771996 11:45655868-45655890 AATGAAGTCTGGGGCCTTCCTGG - Intronic
1081802652 11:45870380-45870402 AATTGACTCTGGGGCATTCCAGG - Exonic
1088152462 11:106761340-106761362 AATTATCTCTGGTGCATTTCTGG + Intronic
1092937496 12:13377671-13377693 TATTGACTCTTGGTCACTCCTGG + Intronic
1095589360 12:43886796-43886818 AATTCACACTGGGGCCTTTCTGG - Intronic
1099178552 12:79452064-79452086 TATTGACTTTGGGGGACTCCTGG + Intergenic
1099225782 12:79967503-79967525 AATTGCCTCTGGGGCTTTTATGG + Intergenic
1100104787 12:91157135-91157157 AATTGAAAATGGGGCTTTCCAGG - Exonic
1100993774 12:100280055-100280077 ATGTGCCTCTGGGGCAATCCTGG + Intronic
1102719370 12:115002933-115002955 AATGGAGACTGGGGCATTGCTGG + Intergenic
1103609781 12:122116132-122116154 AATTGGCTTTGGGACATTACTGG - Intronic
1107494867 13:40916439-40916461 AATTGCCTCTGGGACATTTCGGG - Intergenic
1108668472 13:52655783-52655805 AGTTGCCTCTGGGACATTTCAGG + Intronic
1108691737 13:52865297-52865319 GACTGACTCTGCTGCATTCCTGG + Intergenic
1110960893 13:81624170-81624192 AACTTGCTTTGGGGCATTCCTGG + Intergenic
1113038864 13:106082716-106082738 AATTGGGTCTGGGGCAGCCCAGG - Intergenic
1121981293 14:98456806-98456828 AAATGACTGTGGAGCATCCCAGG + Intergenic
1126137301 15:45403694-45403716 ATTTGACTCTGGGGAAATACAGG - Intronic
1126741064 15:51776458-51776480 AATTGTCTCTAGAGCATGCCAGG - Intronic
1129674939 15:77627422-77627444 AGGTGACTCCGGGGCATTGCAGG - Intronic
1131473109 15:92713518-92713540 AATGGACTCTGGGGACTTGCAGG + Intronic
1131879347 15:96845952-96845974 AATGGACTTTGGGGCATTGGGGG - Intergenic
1132339362 15:101068388-101068410 GATTGCCTCTGTGGCCTTCCAGG + Intronic
1140717293 16:77738313-77738335 AAGTGTCTCTGGGAGATTCCTGG + Intronic
1144189638 17:12832653-12832675 AGTTGACTCTTGTTCATTCCTGG - Intronic
1144207131 17:12987318-12987340 ATTTGGCTTTGGGGCATCCCTGG + Intronic
1151472012 17:74324468-74324490 AAATAACTATGGGGCATTCTGGG + Intergenic
1151848099 17:76672089-76672111 AAAGGAATCTGGGTCATTCCAGG - Intergenic
1154070902 18:11150089-11150111 AATAGACTCTGGGAAATCCCGGG + Intergenic
1155380718 18:25219262-25219284 AGTTGACTCTTGAACATTCCAGG - Intronic
1156805356 18:41172552-41172574 AAGTGAGTCTGGGGTTTTCCAGG + Intergenic
1156866371 18:41893188-41893210 AATGGACTCTGGGGACTTACGGG + Intergenic
1163683519 19:18697144-18697166 CATTGGCTCTCGGGCATCCCTGG - Intronic
1166959138 19:46487546-46487568 CATGGGCTCTGGGTCATTCCAGG - Intronic
1168572205 19:57480629-57480651 GATTGAGTCAGGGGCATTACAGG - Intergenic
925548608 2:5044226-5044248 TATTGACTCTGTAGCAATCCCGG - Intergenic
926768960 2:16351248-16351270 AAATGCCTCTAGGGCATTTCAGG + Intergenic
927685305 2:25166639-25166661 AATGCTCTCTGGGGCTTTCCAGG - Intronic
928329478 2:30346752-30346774 AAATAACACCGGGGCATTCCAGG - Intergenic
929181233 2:39041942-39041964 AAATGACACTGGGTCATACCTGG - Intronic
935391864 2:102561258-102561280 AATTGGTCCTGGGGCATGCCGGG + Intergenic
942463373 2:176185023-176185045 AAGTGACCCTGGGGAATTCATGG + Intergenic
944643815 2:201757355-201757377 AATTGACTTTTGGGGAATCCAGG - Intronic
945187511 2:207154576-207154598 TATTGTCTCTTGGGCATTCCAGG + Intronic
947164126 2:227244308-227244330 ACTTGAATCTAGGGCTTTCCAGG + Exonic
947433481 2:230051863-230051885 AATTAACTCTGTTGCATTACAGG + Intronic
1170012413 20:11739449-11739471 AATTGACTAGGGTTCATTCCAGG - Intergenic
1173375464 20:42478497-42478519 AAATGACTCAGGGGCATTTGGGG - Intronic
1181267423 22:21638787-21638809 AACTGAGGCTGGAGCATTCCAGG + Intergenic
1184789581 22:46691613-46691635 AATTGAACCTGGAGCATTTCCGG + Exonic
951244399 3:20323700-20323722 AATTGTCTCTGGGGGAATCAGGG + Intergenic
952746277 3:36784553-36784575 ACATGACTCAGGGACATTCCGGG + Intergenic
953869706 3:46615621-46615643 AATCCTCTCTGGGGCATGCCAGG + Intronic
955267227 3:57456797-57456819 CATTTACTCTGGGTGATTCCTGG - Intronic
962833206 3:139162066-139162088 ATTTGTCCATGGGGCATTCCTGG - Intronic
963060152 3:141219287-141219309 AAGGCACTCTGGGGCATTCAGGG + Intergenic
963397074 3:144748965-144748987 AGTTCACTCTGGAGAATTCCTGG - Intergenic
967332717 3:188307870-188307892 AATGGACTGTGGGGCATTTTTGG + Intronic
970078383 4:12251489-12251511 AATGGAGTCTGTGTCATTCCGGG + Intergenic
970874550 4:20854468-20854490 AATGGACTCTGGGGACTTGCGGG + Intronic
979409014 4:120351388-120351410 AATGGGAGCTGGGGCATTCCAGG + Intergenic
983546537 4:168970649-168970671 AATGGACTCTGGGGCCTTGCAGG - Intronic
983925725 4:173399879-173399901 AATTGAGGCAAGGGCATTCCAGG + Intronic
987591171 5:19928903-19928925 AATTTAGTCAGAGGCATTCCTGG + Intronic
989753915 5:44928131-44928153 AATGGAGCCTGGGTCATTCCAGG - Intergenic
992465361 5:76998940-76998962 CAATGATTCTGGGGAATTCCTGG - Intergenic
994416625 5:99480298-99480320 AATGGACTCTGGGGAATTGAGGG - Intergenic
994463347 5:100094873-100094895 AATGGACTCTGGGGAATTGAGGG + Intergenic
994659024 5:102631085-102631107 AATTGACTTTGGGGACTTCTGGG - Intergenic
995988909 5:118211771-118211793 AATTGACACTGGGGAAATCTTGG + Intergenic
998918997 5:147047022-147047044 ATTTGACTCTGAGGCATAGCAGG + Intronic
1002347110 5:178555787-178555809 TAGTGACTCGGGGGCATCCCAGG - Intronic
1003134410 6:3423138-3423160 TACTGACACTGGGGCTTTCCTGG + Intronic
1003846299 6:10177454-10177476 AATGGACTCTCTGGCACTCCTGG + Intronic
1004578343 6:16922275-16922297 AAATGACTCTAGGCCATCCCTGG + Intergenic
1005818985 6:29581292-29581314 AATAGACTCTGGGGCACTAAAGG - Intronic
1007116544 6:39347262-39347284 GCTTGACTCTGTGGCATTCTAGG + Intronic
1009763987 6:68044491-68044513 ACATGACTCTGGGGCATTTTAGG - Intergenic
1010976374 6:82319089-82319111 AATGAACTCTGGGGAATTCTGGG + Intergenic
1016173835 6:141053424-141053446 TATAGACTGTGGGCCATTCCAGG - Intergenic
1017857208 6:158360270-158360292 GATGCACTCTTGGGCATTCCTGG + Intronic
1021831701 7:24618713-24618735 TTCTGACTCTGGGCCATTCCAGG + Intronic
1022418777 7:30200931-30200953 AATAGACTCTGTGCCATTTCAGG + Intergenic
1024121061 7:46240950-46240972 AATTGGCTCTTGGGTATTCTTGG + Intergenic
1031207448 7:118778710-118778732 ATTTAAAACTGGGGCATTCCTGG - Intergenic
1033676580 7:143546035-143546057 AGATGACTCTGGGTCATTACTGG + Intergenic
1033695253 7:143783403-143783425 AGATGACTCTGGGTCATTACTGG - Intergenic
1035821234 8:2594317-2594339 AATTGACTCTGGGGACTTGGGGG - Intergenic
1044167786 8:89009134-89009156 AATGGACTTTGGGGCCTTGCGGG + Intergenic
1047226858 8:122962288-122962310 AATAGACTCTGGGGACTTCAGGG - Intronic
1047597257 8:126391372-126391394 AATTGCCTTTGGAGCATTCTGGG + Intergenic
1049462490 8:142736566-142736588 TGGTGACTCTGGGCCATTCCAGG - Exonic
1054857871 9:69920543-69920565 AAATGACTTTGGATCATTCCTGG + Intergenic
1056905888 9:90647363-90647385 AAGTCACTCTTGGGCACTCCGGG - Intergenic
1057687000 9:97243721-97243743 AATTGCCTCTGGGACATTTTGGG + Intergenic
1059516368 9:114899598-114899620 AATGCACTCTGGGGCTTCCCTGG - Intronic
1059990619 9:119861962-119861984 TGTGGACTCTGGGGCAGTCCTGG + Intergenic
1062219607 9:135408036-135408058 ACTTGACTCTGGAGCATCTCAGG - Intergenic
1185565789 X:1094038-1094060 AATTGACTCTGGGGCAGGATTGG - Intergenic
1185575317 X:1167806-1167828 AATTCAAACTGGGGCCTTCCAGG - Intergenic
1186698018 X:12058260-12058282 AATTGCCTCTGGTTCCTTCCTGG - Intergenic
1187237800 X:17484627-17484649 AGTGGGCTCTGGGGCATCCCAGG + Intronic
1190654471 X:52598857-52598879 AACTGTCTCTGTGGCATCCCAGG + Intergenic
1190933840 X:54975459-54975481 AATGGACTCTGGGGACTTGCGGG + Intronic
1193057360 X:77168029-77168051 CATAGACTCTGTGGTATTCCTGG + Intergenic
1195873507 X:109513301-109513323 AATGGACTTTGGGGACTTCCGGG + Intergenic
1196548774 X:116996621-116996643 AAATGTCTCTAGGGCATTTCAGG - Intergenic
1197256411 X:124268162-124268184 CATGGTGTCTGGGGCATTCCAGG + Intronic
1197355760 X:125436249-125436271 AAATGATTTTGGGGCATTACAGG - Intergenic
1198025227 X:132699067-132699089 AATTGGCTCTGGGTCATTCTGGG - Intronic
1201622848 Y:15979687-15979709 ACTTGAGTCTGCGGCATTTCTGG + Intergenic