ID: 1081802753

View in Genome Browser
Species Human (GRCh38)
Location 11:45870950-45870972
Sequence CAACCTCCTGTGGCCTCCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 5, 3: 35, 4: 327}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081802747_1081802753 29 Left 1081802747 11:45870898-45870920 CCCAGCTCGAGCCAGGCTGGCAG 0: 1
1: 0
2: 2
3: 9
4: 241
Right 1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG 0: 1
1: 0
2: 5
3: 35
4: 327
1081802748_1081802753 28 Left 1081802748 11:45870899-45870921 CCAGCTCGAGCCAGGCTGGCAGC 0: 1
1: 0
2: 2
3: 29
4: 219
Right 1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG 0: 1
1: 0
2: 5
3: 35
4: 327
1081802749_1081802753 18 Left 1081802749 11:45870909-45870931 CCAGGCTGGCAGCATGAGCAGTG 0: 1
1: 0
2: 4
3: 70
4: 329
Right 1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG 0: 1
1: 0
2: 5
3: 35
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081802753 Original CRISPR CAACCTCCTGTGGCCTCCTG TGG Intronic
900390170 1:2430415-2430437 CAGCCTCCTCCTGCCTCCTGTGG + Intronic
900391807 1:2436916-2436938 CACCCAGCTGAGGCCTCCTGGGG + Intronic
900693296 1:3994795-3994817 CACCCTTGTGTGGCCTCCTCTGG - Intergenic
901685039 1:10939047-10939069 GGACCTCCTGCTGCCTCCTGTGG + Intergenic
902358322 1:15924857-15924879 CACCCTCCTGCGTCCTCATGAGG - Intronic
902734589 1:18391820-18391842 CTTCATCCTGTGTCCTCCTGTGG + Intergenic
903272895 1:22202781-22202803 CAACCTCCAGGGTCTTCCTGTGG + Intergenic
903362156 1:22783572-22783594 CACACTTCTGTGCCCTCCTGGGG - Intronic
903648494 1:24909129-24909151 CACCCTCCTGCGGCCTGCTGAGG + Intronic
904535833 1:31198855-31198877 CCACCTTGTGTGGGCTCCTGGGG - Intronic
905954202 1:41978465-41978487 CCGCCTCCTGTGTCCTCCTGTGG - Intronic
906523083 1:46478742-46478764 CAACCTCCCATGGCCTGCTTGGG - Intergenic
906664111 1:47606558-47606580 CAGCCTACTGCAGCCTCCTGAGG - Intergenic
906708615 1:47912973-47912995 TAACCTGCTGTGGCCTCTGGTGG - Intronic
907503049 1:54897382-54897404 AAACTTACTGTGGCCCCCTGAGG + Intergenic
908649482 1:66315950-66315972 CACCCTCCTGTGTTCTTCTGAGG + Intronic
909890651 1:81001932-81001954 GAAGCTCCTGTTGCCTTCTGTGG + Intergenic
909895609 1:81065605-81065627 GAACCTCCTGTGGCCAATTGTGG - Intergenic
910293826 1:85624607-85624629 CAACCTCCTTTGGCCTGCCTGGG + Intergenic
914884199 1:151571951-151571973 TGGCCTCCTGAGGCCTCCTGAGG - Intronic
915076314 1:153310795-153310817 TACCATCCTGTGGCTTCCTGAGG + Intergenic
915080384 1:153348070-153348092 TACCATCCTGTGGCCTCCTGAGG + Intronic
916174123 1:162023724-162023746 CAGCCACCTGAGCCCTCCTGCGG - Exonic
917145069 1:171881729-171881751 CAAGCACCTTTGGCCTCCAGTGG + Intronic
917793683 1:178516295-178516317 CAACCACCTGTAGCATCCTTAGG + Intronic
918115407 1:181491945-181491967 CAACCTCCTGTCCCCTCCCTGGG - Intronic
920827895 1:209438742-209438764 TACCCTCCTGTGGCCTTCTCTGG - Intergenic
922219886 1:223550413-223550435 CAGCTCCCTGTGTCCTCCTGTGG + Intronic
922570074 1:226629439-226629461 CAACCTACCGTGGCACCCTGCGG + Intergenic
922773814 1:228205943-228205965 CTGCATCCTGTGGCCTCCCGTGG + Intronic
924930811 1:248730858-248730880 GAAGTTCCTGTGGGCTCCTGTGG - Intronic
1063857597 10:10272179-10272201 CATCCTCCTCTGCCCTCCTCTGG - Intergenic
1064158516 10:12923522-12923544 CCACCACCTCTGGCCTCCTATGG + Intronic
1064483127 10:15759468-15759490 CATCCTCCTGGTGCCTTCTGGGG + Intergenic
1065088400 10:22203797-22203819 CAAATTCCTGTGGCTTTCTGGGG + Intergenic
1065666732 10:28071209-28071231 AAGCCTCCTGTGACCTCCTCAGG - Intronic
1067008686 10:42690520-42690542 CAGCCAGCTGTGGCCACCTGTGG - Intergenic
1067242456 10:44508165-44508187 ACACTTCCTTTGGCCTCCTGTGG - Intergenic
1067794357 10:49310034-49310056 CAAACCCCAGTGGCTTCCTGTGG + Intronic
1069993468 10:72328902-72328924 CAACCTCCTGCCACCTCCTCAGG - Intergenic
1070326471 10:75392727-75392749 GAACTTCCTGTGGCTCCCTGTGG - Intergenic
1070797452 10:79224921-79224943 TAACCTGCTGTGGACACCTGGGG + Intronic
1071013461 10:80966770-80966792 CAACCTCCTATCTCATCCTGTGG - Intergenic
1072063755 10:91844442-91844464 CATGCTCTTGTGGCCTTCTGGGG + Intronic
1073287293 10:102396579-102396601 CAATCCCCTGTGGCCTCCTTCGG - Intronic
1074032356 10:109701571-109701593 CACCCACCTGTGGCCTGGTGGGG + Intergenic
1074904913 10:117853070-117853092 CAAGCTGCGGTGACCTCCTGAGG + Intergenic
1075402825 10:122173253-122173275 CTTACTCCTGTGGCTTCCTGGGG + Intronic
1075896036 10:125995331-125995353 CGTCCTCCTGTGGCCTTCAGGGG - Intronic
1075949928 10:126468421-126468443 CAACCTGCTGAAGCCTCCTCTGG - Intronic
1075975490 10:126690497-126690519 CAACCACCTTGGGCTTCCTGAGG - Intergenic
1076256642 10:129031714-129031736 CTCCCCCCCGTGGCCTCCTGGGG - Intergenic
1076438324 10:130461775-130461797 CAGTCTACTGTGCCCTCCTGGGG + Intergenic
1076663321 10:132069604-132069626 CAACCTCCTGTTGTGTCCAGCGG + Intergenic
1076727659 10:132421101-132421123 CACCCTTCCGTGGCTTCCTGTGG + Intergenic
1077154956 11:1087139-1087161 CTCCCTCCTCTGGCCTCCTCTGG + Intergenic
1077154975 11:1087193-1087215 CTCCCTCCTCTGGCCTCCTCTGG + Intergenic
1078502474 11:11894719-11894741 CAACTTCCTGTGGCTCTCTGAGG + Intronic
1079297337 11:19244940-19244962 GACTCTCCTGTGACCTCCTGTGG + Intergenic
1079394496 11:20050179-20050201 GCATCTCTTGTGGCCTCCTGTGG + Intronic
1080503050 11:32888290-32888312 CCCCCTGCTGTGGGCTCCTGTGG - Intergenic
1081802753 11:45870950-45870972 CAACCTCCTGTGGCCTCCTGTGG + Intronic
1081993490 11:47349863-47349885 CAGCCTCCTGAAGCCGCCTGTGG - Exonic
1082140909 11:48607991-48608013 CAACCTCCTGTCGGTCCCTGGGG - Intergenic
1082612354 11:55316464-55316486 CAACTTCCTGTGGGTCCCTGGGG - Intergenic
1082618057 11:55386444-55386466 CAACCTCCTGTGGGTCCCTGGGG - Intergenic
1082622405 11:55440089-55440111 CAGCCTCCTGTGGGTCCCTGGGG - Intergenic
1082623723 11:55458146-55458168 TTACCTCCTGTGGGTTCCTGGGG - Intergenic
1083245976 11:61428891-61428913 CACCCACCTTTGGCTTCCTGGGG + Intronic
1084319332 11:68364767-68364789 CACCCTCCTGTGTCCTGCTCTGG - Intronic
1084532354 11:69735126-69735148 CCACCTGCCTTGGCCTCCTGAGG - Intergenic
1084575118 11:69984254-69984276 CATCCTCTTTTGCCCTCCTGGGG + Intergenic
1084792067 11:71481268-71481290 CAGCCTCCTGGGGCCTGCTTGGG + Intronic
1084943545 11:72626869-72626891 CAACCTCCTGCAGCCTCCTCTGG + Intronic
1086613187 11:88781739-88781761 CAATCTCCTCTGGCCACCTCAGG + Intronic
1087054148 11:93917084-93917106 CAAGCTTCTGGGGCCTCCTGAGG - Intergenic
1088563821 11:111146170-111146192 CCATGTCCTGGGGCCTCCTGTGG - Intergenic
1088702171 11:112423090-112423112 AATCCTCCTGTGAGCTCCTGGGG - Intergenic
1089113417 11:116074668-116074690 CAACCTGCTGTGGCCCCAGGAGG + Intergenic
1089310695 11:117556361-117556383 AAACCTTCTGTGGCCCTCTGTGG - Intronic
1090323943 11:125868844-125868866 CCATCTCCTGTGGACTCCTGAGG - Intergenic
1090423830 11:126593491-126593513 CAACCTGCTGTGACCCCCTCTGG + Intronic
1091225191 11:133952949-133952971 CCACATCCTGTGGCCTTCTCAGG - Intronic
1092193612 12:6536364-6536386 CAACCTCTTGGGCCCTCCTGGGG + Intronic
1093308662 12:17550685-17550707 CAACCTACTATGGCCAACTGTGG - Intergenic
1093941875 12:25064055-25064077 CCACCTGCTGTGGCCTCCCAAGG - Intronic
1095574257 12:43716988-43717010 CAACCACCTATGGCTTTCTGTGG + Intergenic
1096556751 12:52408567-52408589 CCTCCTCCTGTGTCCTTCTGGGG + Intergenic
1096669687 12:53191222-53191244 CATCCTCCTCTTGCCACCTGAGG - Exonic
1096834264 12:54338907-54338929 AAACCTCCTGAAGCCTCATGAGG + Intronic
1100149144 12:91714330-91714352 CCACATCCTGTGGCAACCTGTGG - Intergenic
1102256771 12:111419856-111419878 AAACCTCATGTGGTATCCTGGGG - Intronic
1103139686 12:118537547-118537569 CAGGCTCCTGCGGGCTCCTGTGG - Intergenic
1103680511 12:122690145-122690167 GCACCTTCTGGGGCCTCCTGTGG + Intergenic
1104747396 12:131219182-131219204 CAAGCTCCTGGGGCGGCCTGTGG - Intergenic
1113525223 13:110969328-110969350 CCATCTCCTGTGGACTTCTGAGG + Intergenic
1113635214 13:111914752-111914774 GCACCTCCTCTGGCCTTCTGAGG + Intergenic
1113738855 13:112697150-112697172 CTGCTTCCTGTGGCGTCCTGCGG + Intronic
1114647008 14:24261476-24261498 CATCCTCCTCAAGCCTCCTGGGG - Intronic
1115364998 14:32547956-32547978 CTACTTCCAATGGCCTCCTGAGG - Intronic
1119701163 14:76755774-76755796 CAGCCTGGTGTGGCCTCCAGGGG - Intergenic
1120363920 14:83541426-83541448 CAATCTGCTGCAGCCTCCTGTGG - Intergenic
1120989653 14:90363962-90363984 CCACCTGCCTTGGCCTCCTGAGG - Intergenic
1121428678 14:93872049-93872071 CCACCTCCTGTGCCCTCCACAGG - Intergenic
1121637522 14:95463728-95463750 CAGTCTCCTGGAGCCTCCTGTGG + Intronic
1122157084 14:99756184-99756206 CCACCTGCAGTCGCCTCCTGGGG - Intronic
1122287995 14:100664023-100664045 CCCCCTCCTCTGCCCTCCTGTGG + Intergenic
1122327392 14:100890821-100890843 TGGCCTGCTGTGGCCTCCTGTGG + Intergenic
1122394059 14:101410216-101410238 CAGCCCACTGTGGCCTCCAGAGG + Intergenic
1122898241 14:104771089-104771111 CTACCTCCTGTCGCCTGCTGGGG - Intronic
1124561125 15:30774325-30774347 CACCCTTCTCTGGCCTGCTGGGG + Intergenic
1124669405 15:31624734-31624756 CACCCTTCTCTGGCCTGCTGGGG - Intronic
1125690031 15:41588569-41588591 CCATCTCCTGTGGACTTCTGAGG + Intergenic
1128108025 15:65058639-65058661 CAACCTCCTCTGCCCCCCGGCGG - Intronic
1128730920 15:70020563-70020585 CAACCTGCTGTTGACTGCTGAGG + Intergenic
1129156626 15:73722209-73722231 CAACCTCCTCTCTCCTCCTGTGG + Intergenic
1130660837 15:85830550-85830572 CATCCTCCTATGGCCACCGGTGG + Intergenic
1131957325 15:97750238-97750260 AAAGCAACTGTGGCCTCCTGTGG + Intergenic
1132605583 16:792471-792493 CCACCTCCTGTGGCCCCTTGCGG - Exonic
1132635305 16:942231-942253 CATCATCCTCTGGCCTCCAGTGG + Intronic
1132663334 16:1071104-1071126 CAAGCACCTGGGCCCTCCTGGGG - Intergenic
1133330486 16:4970251-4970273 GACCCTCCTATGGCCTCCAGTGG - Intronic
1134059664 16:11191465-11191487 CCACCTGCTGAAGCCTCCTGGGG - Intergenic
1134070435 16:11256637-11256659 ACACCTTCTGTGGCCTCCTAGGG - Intronic
1134515863 16:14886287-14886309 CAACCCCCTGACGACTCCTGAGG - Intronic
1134703536 16:16284931-16284953 CAACCCCCTGACGACTCCTGAGG - Intronic
1134964007 16:18427183-18427205 CAACCCCCTGACGACTCCTGAGG + Intronic
1134968294 16:18509719-18509741 CAACCCCCTGACGACTCCTGAGG + Intronic
1136185964 16:28589233-28589255 CACCCTCCTGTGGGGGCCTGTGG + Intronic
1136498527 16:30658510-30658532 CAAACTCCTGTTGTCTCCTTTGG - Exonic
1136509168 16:30725096-30725118 CAACTTCCTGTTCCCTCTTGAGG - Intronic
1137402376 16:48164026-48164048 CAACCTCCTATCTCATCCTGTGG + Intergenic
1138331060 16:56215642-56215664 AAACCTCCTGTGGATTCTTGGGG + Intronic
1138576848 16:57913092-57913114 CACCGTCCTGTTCCCTCCTGGGG - Intronic
1141099870 16:81189358-81189380 CAAGCCCCAGTGGCCTCCCGTGG + Intergenic
1141846258 16:86611001-86611023 CAAGCTCCTGAGACCTGCTGAGG - Intergenic
1142332939 16:89467186-89467208 CCACCTGCTGTGGCCTCCCCAGG - Intronic
1142358976 16:89617351-89617373 GGAGCTCCTGTGGCCTCGTGAGG - Intronic
1142471116 17:163911-163933 CCACACCCTGTTGCCTCCTGGGG - Intronic
1144335877 17:14268523-14268545 CCAGCCCCTGTGGGCTCCTGGGG - Intergenic
1144630496 17:16869713-16869735 AGACCTCCTGGGGCCTGCTGAGG + Intergenic
1145271723 17:21408392-21408414 CCACCTCCTGTGGGGCCCTGGGG + Intronic
1145960640 17:28884759-28884781 CAACTTCCTGGGGCACCCTGGGG - Intronic
1146275299 17:31512439-31512461 CCACCCCCAGGGGCCTCCTGGGG + Intronic
1148178527 17:45586878-45586900 CAACCTCCTGTGGTCTGCTGGGG + Intergenic
1148270628 17:46259577-46259599 CAACCTCCTGTGGTCTGCTGGGG - Intergenic
1148611876 17:48970058-48970080 CACCCTCCTGTGAGCCCCTGAGG - Intergenic
1149354507 17:55826240-55826262 CATCCTCATGTGGCCTCCTCTGG + Intronic
1151315532 17:73319738-73319760 CAACCTCCTCTTGCCCACTGCGG - Intergenic
1151571442 17:74927870-74927892 CAGTCTCCTGTGCCCTCATGAGG + Intronic
1151875416 17:76865412-76865434 CAAATACTTGTGGCCTCCTGAGG - Intergenic
1152224184 17:79085137-79085159 CAGCCTTCTCTGGACTCCTGGGG + Intronic
1152461483 17:80444562-80444584 CACCCTCCTGTGCCCAGCTGGGG + Intergenic
1152549147 17:81020765-81020787 TGACCTCCTGGGGCCTCCTTCGG - Intergenic
1152568193 17:81109591-81109613 CAAGCTCGAGGGGCCTCCTGAGG + Intronic
1155062101 18:22237779-22237801 CATCCTCCTGTGGAACCCTGTGG + Intergenic
1155171088 18:23267282-23267304 CAACCCCCAGTGGTGTCCTGAGG - Intronic
1155497868 18:26460429-26460451 CACCCTCCTGTGGCCACCAAAGG - Intronic
1155631884 18:27904132-27904154 CTTCCTGCTGTGTCCTCCTGTGG + Intergenic
1156371475 18:36475172-36475194 GAACCACCTGTGGGCTTCTGGGG - Intronic
1156856788 18:41791504-41791526 CATCCCCCTGTGTCCTCCTGAGG - Intergenic
1157189410 18:45568155-45568177 CTCCCTCCTGTGTCTTCCTGAGG + Intronic
1157207108 18:45710117-45710139 CAAACCCCTGTGTACTCCTGGGG - Intergenic
1157443971 18:47731091-47731113 CAACCCCATGTGGCCCTCTGTGG - Intergenic
1158267116 18:55671763-55671785 TAACTTCCTGTGCCCTGCTGGGG - Intergenic
1159908325 18:74119026-74119048 CAGCCTCCTGGGGCCTCCCCAGG + Intronic
1160224867 18:77004922-77004944 GAAGCTCCCGTGGCCTCCTTTGG + Intronic
1160325637 18:77945057-77945079 CAGCCTCCGGAGGCCACCTGTGG + Intergenic
1160623956 18:80190299-80190321 CACCCTCCTCTGGCCTCTGGTGG - Intronic
1160625087 18:80198602-80198624 CACACTCCTGTGCCCACCTGGGG + Intronic
1160913005 19:1483485-1483507 GACCCTCCTGCGGCCTGCTGGGG + Intronic
1161465874 19:4430042-4430064 CAGCCCCCTCTTGCCTCCTGCGG + Intronic
1161509359 19:4662055-4662077 GACCCTCCTGATGCCTCCTGGGG + Intronic
1161586740 19:5109775-5109797 CGCCCTCGTGAGGCCTCCTGAGG + Intronic
1161657288 19:5524072-5524094 CAAGCTCCCGTGGCCTCAGGGGG - Intergenic
1162795885 19:13087460-13087482 CAACTTCTGGTGGCCTCCTGAGG + Intronic
1165745898 19:38229389-38229411 CCACCCCCTGTCGCCCCCTGGGG - Intronic
1166076975 19:40419431-40419453 CAAGGTGGTGTGGCCTCCTGGGG + Intergenic
1166572064 19:43803351-43803373 CCACCTGCTGGGGCCTCCTCTGG - Intronic
1167095855 19:47374859-47374881 CAATCTCCTGTGTCCTCCATCGG + Intronic
1167695461 19:51013199-51013221 CAACCTCCTGTGGGCTCTGCAGG + Exonic
1168107359 19:54173035-54173057 CTACCTCCTCTGGCCTCCCGGGG + Exonic
1168267738 19:55231618-55231640 CTGCCTTCTGTGGCTTCCTGAGG + Exonic
1168326206 19:55539758-55539780 CAGCCCTCTCTGGCCTCCTGGGG - Intergenic
1168465896 19:56600957-56600979 GAACCACCTGTGGCCTCTTTGGG - Intronic
926176123 2:10593817-10593839 CAACCTCTTGTGACCTACAGTGG + Intronic
927762072 2:25766836-25766858 AAACCTCCTGTCTCCTGCTGGGG + Intronic
927878801 2:26676095-26676117 CTGCCCACTGTGGCCTCCTGTGG - Intergenic
928207161 2:29293796-29293818 AATCCTTCTGTGGCTTCCTGTGG - Intronic
928260703 2:29764038-29764060 AGACATCCTGTGACCTCCTGTGG + Intronic
928264596 2:29800930-29800952 CTCCCTCCTGTGGGCTCCCGTGG + Intronic
928868733 2:35949871-35949893 CAACCTCCTTTGGATTCCAGGGG - Intergenic
932502049 2:72191469-72191491 CAACCAGCTGTGGCATCTTGGGG - Intronic
933389748 2:81654542-81654564 CCATCTCCTGTGGTCTTCTGAGG - Intergenic
934637845 2:96007193-96007215 CACCCTCCTCTGGCTTGCTGTGG - Intergenic
934795817 2:97098218-97098240 CACCCTCCTCTGGCTTGCTGTGG + Intergenic
934856693 2:97734303-97734325 CACCCTCATGTGGCTTCATGGGG + Intronic
935471819 2:103469917-103469939 CAACCTCCTATCTCATCCTGTGG + Intergenic
935756987 2:106283925-106283947 CCTCCTCCTGTCTCCTCCTGTGG - Intergenic
936027787 2:109046775-109046797 CTGCCTCCTCTGGGCTCCTGTGG + Intergenic
936112577 2:109677111-109677133 CCTCCTCCTGTCTCCTCCTGTGG + Intergenic
936285819 2:111180456-111180478 AGACCTCCTGTGGTCTCTTGTGG - Intergenic
936812778 2:116422044-116422066 TAGCCTCCTTTGGGCTCCTGAGG + Intergenic
937278440 2:120701459-120701481 AAAACTCCTTAGGCCTCCTGGGG + Intergenic
937914052 2:127090285-127090307 CAACCCGCTGTGGCCACATGAGG + Intronic
939292313 2:140212130-140212152 CAACCTCCTGTCTCATCCTGTGG + Intergenic
940352529 2:152705268-152705290 CCATCTCCTGTGGACTTCTGAGG + Intronic
941846795 2:170141695-170141717 CAGCCTGCTGGGGCCGCCTGAGG - Intergenic
941923736 2:170875707-170875729 CAACCTCCTTTACCCTCCTCAGG + Intergenic
942925811 2:181430724-181430746 TAACCTCCTGTCTCATCCTGTGG + Intergenic
946010411 2:216559867-216559889 CAGCCTCTTGTGGACTCCCGTGG + Intronic
947286860 2:228526858-228526880 CAACCTGCTGTGTCCACCTGAGG + Intergenic
947875951 2:233468427-233468449 CAACCTCCTCTGTCCCCCAGAGG - Exonic
948560656 2:238849077-238849099 AAACCTCCTGGGGCCGGCTGGGG + Intronic
948684995 2:239664710-239664732 AAACATCCAGTGGGCTCCTGTGG - Intergenic
1170075712 20:12416453-12416475 CCAGCTCCTCTGGCCTCATGTGG + Intergenic
1172590113 20:36111916-36111938 CAACCTCCAGATGCCTCCTCAGG - Intronic
1174110299 20:48193980-48194002 CAGTCTCCTCTGGCCTCATGTGG - Intergenic
1175057041 20:56208077-56208099 CAACCTCTTATCTCCTCCTGTGG - Intergenic
1175217457 20:57399111-57399133 CCAGCTCCTGTCGCCTTCTGAGG - Intronic
1175567921 20:59995374-59995396 CAGGCTCCAGTGTCCTCCTGGGG - Intronic
1176076006 20:63248480-63248502 CACCCTCCTGGGGCCACGTGGGG - Intronic
1176162913 20:63657698-63657720 CTCCCTCCTGGGGCCTTCTGGGG + Intergenic
1176370422 21:6058863-6058885 CACCCTTCTCTGGCCTCCTCTGG - Intergenic
1176654857 21:9579446-9579468 CAGCCTCCTGTGCCTCCCTGGGG + Intergenic
1177151571 21:17460343-17460365 CATGCTCCTGTGGTCTCCTGTGG + Intergenic
1178629095 21:34243764-34243786 CTCCCTCTTGTGGTCTCCTGGGG + Intergenic
1179456860 21:41506523-41506545 CAACCTCCAGTGACTTTCTGGGG + Intronic
1179753097 21:43479678-43479700 CACCCTTCTCTGGCCTCCTCTGG + Intergenic
1180079304 21:45479661-45479683 GAACCTGCTGTGACCTCCCGAGG + Intronic
1180902544 22:19385292-19385314 TGACCTCCTCTGGGCTCCTGGGG + Intronic
1182443499 22:30377334-30377356 CCGCCTTCAGTGGCCTCCTGGGG - Intronic
1183307478 22:37090303-37090325 CAACCTTCTGTGGCTCCCTATGG - Intronic
1183623129 22:38986459-38986481 CATCCTCCTGAGGCCTCCGTTGG + Intronic
1183633143 22:39045592-39045614 CATCCTCCTGAGGCCTCCCCTGG + Intronic
1184066102 22:42122195-42122217 CAACCTCCGGTTGCTTCCTGAGG + Intergenic
1184407302 22:44307442-44307464 AAAGCTTCTGAGGCCTCCTGAGG + Intronic
1184489307 22:44799956-44799978 CAACCTCTTCTGGCCACTTGTGG + Intronic
1184630247 22:45771865-45771887 CCTCCTGCTTTGGCCTCCTGAGG + Intronic
1184843176 22:47064328-47064350 GAACCACAAGTGGCCTCCTGTGG - Intronic
1184941857 22:47773913-47773935 CTTCCTCCTGTGTCCTCCTGTGG - Intergenic
950448969 3:13055017-13055039 GAGCCTTCTGTGGCCTTCTGAGG - Intronic
950704941 3:14773717-14773739 CAGAGCCCTGTGGCCTCCTGGGG + Intergenic
951568216 3:24034400-24034422 CAACCCCCTGCAGCCTGCTGTGG - Intergenic
952280644 3:31919975-31919997 CAACTTTCTGTGCCCTCCAGAGG + Intronic
952538997 3:34346274-34346296 CACACACCTGTTGCCTCCTGAGG - Intergenic
952577234 3:34790152-34790174 CAGCTTCCTGTGGGCTCCTTTGG - Intergenic
953627066 3:44580123-44580145 CAATCACCTGGGACCTCCTGTGG + Intronic
953805272 3:46062736-46062758 CAAGGCCCTGTTGCCTCCTGGGG - Intergenic
954131545 3:48563729-48563751 CAGCCTGCTGTGGCTGCCTGGGG + Exonic
954394719 3:50287448-50287470 CAGCCTCCTGGCTCCTCCTGTGG + Exonic
955396345 3:58560432-58560454 CCACCTGCTTTGGCCTCCTCAGG - Intergenic
956191343 3:66611123-66611145 CAAACTCCTCAGGCCTCCTTTGG + Intergenic
961389695 3:126544974-126544996 CCACCTGCTCTGGCCTGCTGTGG + Intronic
961457933 3:127033447-127033469 CTGCCTCCTGTGGCACCCTGGGG - Intronic
961803108 3:129467944-129467966 CAACCCCCTTTTACCTCCTGGGG - Intronic
963301050 3:143597597-143597619 CACCCGCCTGTGGCCCCCCGAGG + Intronic
965322995 3:167270404-167270426 CCATCTCCTGTGGACTTCTGAGG + Intronic
967923109 3:194627381-194627403 AAACCTGTTGTGCCCTCCTGCGG - Intronic
967979705 3:195058545-195058567 CTCCCTCCTGTGGCCCCCTCTGG + Intergenic
968502850 4:959224-959246 CAGCCTGCTGCAGCCTCCTGGGG - Exonic
968551066 4:1223577-1223599 CATCCCCATGGGGCCTCCTGAGG + Intronic
968665796 4:1821779-1821801 CAACCTGCTGTCACCTCCTGTGG - Intronic
968814043 4:2812586-2812608 CCACCTCCTGTGGGCTCCCACGG - Intronic
969361083 4:6664214-6664236 CGCCCCCCTGTCGCCTCCTGAGG + Intergenic
970494077 4:16608326-16608348 CAGCCCCCTGTGGACTCCCGAGG - Intronic
974074761 4:57158426-57158448 CACCCTCCAGTGGCCTCTTGTGG + Intergenic
975510994 4:75193761-75193783 CAGCCTCCAGGTGCCTCCTGAGG + Intergenic
976469271 4:85408484-85408506 CAATCTCCTGTGGCCTCTTCTGG - Intergenic
981509392 4:145538932-145538954 CAACCTCCAGAAACCTCCTGAGG - Intronic
984704353 4:182836863-182836885 CAACGTGCTCTTGCCTCCTGAGG - Intergenic
985110299 4:186541085-186541107 CATGCTCCTATGGCCTCATGAGG + Intronic
985171353 4:187153585-187153607 CCACCTCCTGCGTCCTCATGTGG + Intergenic
988134023 5:27145540-27145562 CAGCCTCCTGAGGACTCCTGCGG + Intergenic
989108972 5:37889065-37889087 CAACCTGCTGTGGCTGCCTCTGG + Intergenic
992096735 5:73369762-73369784 CAACCTCCATTGGCATCCTTTGG - Intergenic
993511167 5:88773061-88773083 CAGCCGCCTGTGGCTGCCTGGGG + Intronic
996647125 5:125829445-125829467 AAAAGTCCTGTTGCCTCCTGGGG - Intergenic
996684870 5:126269096-126269118 CAACCTCCTATCTCGTCCTGTGG + Intergenic
997612239 5:135223287-135223309 CAAGGTCTTGTGCCCTCCTGGGG + Intronic
997955503 5:138275585-138275607 CATCCTGCTGTGGCCTCTGGGGG + Intergenic
998266516 5:140671322-140671344 CAACCTCCTGTGGTCTGCTGGGG - Exonic
999241345 5:150129655-150129677 CTAACTCCTTTGGCCTGCTGTGG + Intronic
1001084876 5:168693251-168693273 AAGCCTCCTCTGACCTCCTGGGG - Intronic
1001099022 5:168798642-168798664 CAAATTCCTGCTGCCTCCTGGGG - Intronic
1001140122 5:169137412-169137434 CAGCCCCCTGAGGCCTCCTCAGG - Intronic
1001324897 5:170715994-170716016 CACCCTCCTGTTGCCACCTGGGG - Intronic
1001411120 5:171512752-171512774 CAACCTCCTGGGGCCTACATTGG + Intergenic
1003163315 6:3654638-3654660 CATCTTCCTGTGACCTCCTCTGG + Intergenic
1003669079 6:8139190-8139212 CATCCTCCTGGTGCCTGCTGGGG + Intergenic
1003672452 6:8171808-8171830 CCATCTCCTGCTGCCTCCTGTGG - Intergenic
1006409385 6:33863509-33863531 CATCCTCCTGTGGGCTCCTGAGG + Intergenic
1007706320 6:43793604-43793626 CATCCTCTTGTGGCCTCCCCAGG - Intergenic
1009610679 6:65937191-65937213 CAGCCTCCCTTGACCTCCTGAGG + Intergenic
1011241384 6:85274883-85274905 CAACCTTCTGTTGCCTTCTAGGG - Intergenic
1012988547 6:105900524-105900546 AAACGTCCTGTTGCCTCCTGAGG + Intergenic
1013480697 6:110550450-110550472 CCACCGCCTGTGGCCTCCTGTGG + Intergenic
1013803391 6:113971161-113971183 CACCTCCCTGCGGCCTCCTGAGG - Exonic
1013989544 6:116237537-116237559 CAGTCTCCTGGGGACTCCTGAGG + Intronic
1015519202 6:134114520-134114542 CAGCCACCTGAGGCCGCCTGGGG - Intergenic
1017783244 6:157733060-157733082 CAGCCTTCTGTGGCCACCTGAGG + Intronic
1018706594 6:166467979-166468001 CAACATGCTGTGACCCCCTGAGG + Intronic
1019225508 6:170504351-170504373 CCAGCTTCTGTGGCTTCCTGTGG - Intergenic
1019256510 7:55916-55938 CTCCCTCCTGTGGCCTCAGGTGG + Intergenic
1019645617 7:2127316-2127338 CAGCCTCCTGTGTCTTGCTGGGG - Intronic
1019779717 7:2932157-2932179 CAGCCTCCTGTGAAGTCCTGTGG + Intronic
1020097515 7:5377087-5377109 GAACCTCCTGGGGCCTCCAGTGG + Intronic
1021493694 7:21248509-21248531 CAACCTTCTTTGCCCTACTGGGG + Intergenic
1023284313 7:38603476-38603498 CAACCTCCTTTGGACTCCATGGG + Intronic
1023760197 7:43458460-43458482 CAAACTCCTGTGCCCTCCAGTGG + Intronic
1024584265 7:50827460-50827482 CTTCCTCCTGTGGCCCACTGGGG - Intergenic
1025605785 7:63039012-63039034 CCCCCTCCTGCTGCCTCCTGGGG - Intergenic
1025695369 7:63771864-63771886 CACCCCACGGTGGCCTCCTGGGG - Intergenic
1028902730 7:96119077-96119099 CTACCTCCATTGGCTTCCTGGGG + Intergenic
1032089837 7:128905915-128905937 CTGCCTCCTGTGCCCTCCTCTGG + Intronic
1032092408 7:128917616-128917638 CTGCCTCCTGTGCCCTCCTCTGG - Intergenic
1033049614 7:137992256-137992278 AAACCCTCTGTGGCATCCTGTGG - Intronic
1033097820 7:138446263-138446285 CCATCTCCTGTGGACTTCTGAGG - Intergenic
1034150403 7:148910642-148910664 CAGCCTCCAGGGGCCTCCTCAGG + Intergenic
1034281373 7:149856800-149856822 CATCCTCCAGTGGCTTCCTAAGG + Intronic
1034859473 7:154583332-154583354 CAATCTCCTCAGGCCTCCTGTGG + Intronic
1035037388 7:155904066-155904088 CATCCCTCTGTGGCATCCTGTGG - Intergenic
1035368448 7:158363237-158363259 CATCCTCCTGTAGCCTCTCGTGG - Intronic
1035829293 8:2676908-2676930 CAAATACCTGTGGCCTGCTGTGG - Intergenic
1035970054 8:4238055-4238077 CAATCTCTTGAGGCCTCCTAGGG - Intronic
1036806035 8:11834448-11834470 ACACTTCCTGTGCCCTCCTGTGG + Intronic
1037157090 8:15715500-15715522 CATCCTGCTGTGTCCTCCTTGGG - Intronic
1037527981 8:19746217-19746239 CAGTCTCCTGTGAGCTCCTGGGG + Intronic
1039080071 8:33725381-33725403 CAGCCTCCTATCTCCTCCTGTGG - Intergenic
1039393601 8:37203433-37203455 CATCTTCTTGTGGCCTTCTGTGG + Intergenic
1040434558 8:47377647-47377669 AAACCTGCTGTTTCCTCCTGAGG - Intronic
1041464754 8:58146740-58146762 CGCCCTCCTGCGGGCTCCTGCGG - Exonic
1042914382 8:73860889-73860911 CCTCCTCCCTTGGCCTCCTGAGG - Intronic
1048018322 8:130517126-130517148 CAAGTTCCTGTTGCCTCCTGAGG + Intergenic
1048036605 8:130683081-130683103 CAACCTAAAGTGCCCTCCTGAGG - Intergenic
1049094346 8:140539679-140539701 CAACCTCCTGGGCCCTCCAGGGG - Intronic
1049199819 8:141334539-141334561 CAACCTCCCGTGGACTGTTGGGG + Intergenic
1049357141 8:142194541-142194563 CAACCTCCTCTGACCTTCCGAGG - Intergenic
1049425507 8:142536271-142536293 CCACCTCCTGTGGGCTGCTCTGG - Intronic
1049529959 8:143149182-143149204 CACCCTCGTGTGCCCTTCTGGGG + Intergenic
1049550113 8:143253434-143253456 CAACCTTCTGTGGTCCCCCGTGG - Intronic
1049606758 8:143533138-143533160 CAACCCCCCGTTCCCTCCTGTGG + Intronic
1049671956 8:143873859-143873881 CCACCTCCTGCTGGCTCCTGAGG + Intronic
1052999631 9:34570855-34570877 GAACTTCCTGGGGCTTCCTGTGG + Intronic
1053018044 9:34675268-34675290 CAACCTCATGGGGCCTGCAGAGG + Intergenic
1053259611 9:36650660-36650682 CATCCTCCAGTGACTTCCTGAGG - Intronic
1054858917 9:69929938-69929960 CCATCTCCTGTGGACTTCTGAGG - Intergenic
1055410200 9:76020889-76020911 AAACCTGCCGTGGCCACCTGCGG - Intronic
1056552048 9:87660134-87660156 CGGCCTCCAGTGCCCTCCTGCGG + Intronic
1056893031 9:90513931-90513953 CAGCTTCCTGTAGCCTGCTGGGG - Intergenic
1057198435 9:93127786-93127808 CAACCTCCTGGGGCCCTCTCTGG + Intronic
1058438438 9:104985846-104985868 CAACCTCAGGTGGCCTCTTCAGG - Intergenic
1058902896 9:109457708-109457730 GAACTCCCTGTGGCCTCCAGTGG + Intronic
1059058861 9:111014220-111014242 CAACCTCCAGAGGCCTTGTGGGG + Intronic
1059437556 9:114285699-114285721 GCACCTTCTGTGGCTTCCTGTGG - Intronic
1060514459 9:124257424-124257446 CCACTTCCTGTGGCCCCCGGGGG - Intergenic
1060691908 9:125669235-125669257 CCACCCACCGTGGCCTCCTGAGG - Intronic
1061682741 9:132250938-132250960 TCACCTCCTGGGGCCCCCTGGGG + Intergenic
1061856320 9:133443647-133443669 CCTCCTCCTGAGGCCTCCGGCGG + Intronic
1185513564 X:681028-681050 CGACCTCCTGTGCTCTCATGTGG + Intergenic
1187449265 X:19382311-19382333 CTACCTCCTGTGTCCCCCTCTGG + Intronic
1187492008 X:19760954-19760976 CACCCTCCAGTAGCCTTCTGAGG - Intronic
1192639356 X:72847622-72847644 CAGCCGCCTGTGGCCTACTGTGG + Intronic
1192642355 X:72873183-72873205 CAGCCGCCTGTGGCCTACTGTGG - Intronic
1193846767 X:86481161-86481183 CCACCTCCTTTGGTCTCCTCAGG + Intronic
1200796093 Y:7342606-7342628 CAGCCTCCTGTCTCATCCTGTGG + Intergenic
1201471208 Y:14336729-14336751 AAACCTCCTCTGTCCTTCTGGGG - Intergenic
1201589664 Y:15601224-15601246 CAGCCTCCTCTGCCCTCCAGGGG + Intergenic