ID: 1081804139

View in Genome Browser
Species Human (GRCh38)
Location 11:45881000-45881022
Sequence ATGCTCGCTCTATCTCTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 119
Summary {0: 1, 1: 1, 2: 0, 3: 2, 4: 115}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081804139_1081804143 13 Left 1081804139 11:45881000-45881022 CCGGGCAGAGATAGAGCGAGCAT 0: 1
1: 1
2: 0
3: 2
4: 115
Right 1081804143 11:45881036-45881058 CGCGTGTGCAGAGGAGGGAGTGG 0: 1
1: 0
2: 3
3: 22
4: 351
1081804139_1081804141 7 Left 1081804139 11:45881000-45881022 CCGGGCAGAGATAGAGCGAGCAT 0: 1
1: 1
2: 0
3: 2
4: 115
Right 1081804141 11:45881030-45881052 TGTGTGCGCGTGTGCAGAGGAGG 0: 1
1: 1
2: 8
3: 99
4: 865
1081804139_1081804142 8 Left 1081804139 11:45881000-45881022 CCGGGCAGAGATAGAGCGAGCAT 0: 1
1: 1
2: 0
3: 2
4: 115
Right 1081804142 11:45881031-45881053 GTGTGCGCGTGTGCAGAGGAGGG 0: 1
1: 1
2: 2
3: 43
4: 395
1081804139_1081804140 4 Left 1081804139 11:45881000-45881022 CCGGGCAGAGATAGAGCGAGCAT 0: 1
1: 1
2: 0
3: 2
4: 115
Right 1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG 0: 1
1: 5
2: 80
3: 863
4: 4332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081804139 Original CRISPR ATGCTCGCTCTATCTCTGCC CGG (reversed) Exonic