ID: 1081804140

View in Genome Browser
Species Human (GRCh38)
Location 11:45881027-45881049
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 5281
Summary {0: 1, 1: 5, 2: 80, 3: 863, 4: 4332}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081804139_1081804140 4 Left 1081804139 11:45881000-45881022 CCGGGCAGAGATAGAGCGAGCAT 0: 1
1: 1
2: 0
3: 2
4: 115
Right 1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG 0: 1
1: 5
2: 80
3: 863
4: 4332
1081804136_1081804140 23 Left 1081804136 11:45880981-45881003 CCTGCAGAGAAGCTGATCACCGG 0: 1
1: 0
2: 2
3: 8
4: 81
Right 1081804140 11:45881027-45881049 GTGTGTGTGCGCGTGTGCAGAGG 0: 1
1: 5
2: 80
3: 863
4: 4332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr