ID: 1081805566

View in Genome Browser
Species Human (GRCh38)
Location 11:45888126-45888148
Sequence GGCTGAGGAGAGCCGCCTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 221}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081805562_1081805566 18 Left 1081805562 11:45888085-45888107 CCTAAGAATCAGATGAGATAACA 0: 1
1: 0
2: 0
3: 40
4: 312
Right 1081805566 11:45888126-45888148 GGCTGAGGAGAGCCGCCTGTAGG 0: 1
1: 0
2: 1
3: 16
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081805566 Original CRISPR GGCTGAGGAGAGCCGCCTGT AGG Intronic
900534507 1:3170370-3170392 GGGTGGGGAGAGCAGCCTGAAGG - Intronic
901508599 1:9702361-9702383 GGCTGAAGAGAGACGCCTTAGGG + Intronic
902800242 1:18825031-18825053 GGCTGGGCAGAGCAGCCTGTGGG - Intergenic
902877586 1:19350067-19350089 GGAGGAGGAGAGGCGCCTGCTGG - Intronic
903651293 1:24923768-24923790 GGCTGAGGGGAACCGCTGGTTGG - Intronic
904379548 1:30101699-30101721 GGATGAGGACGGCCTCCTGTGGG - Intergenic
906179426 1:43805621-43805643 AGCAGAGGAGAGGCGTCTGTCGG + Intronic
907273768 1:53305762-53305784 GGCTGAGGAGAGACTAGTGTGGG - Intronic
908486124 1:64595528-64595550 GGCTGGGGAGAGCAGCTTGGTGG - Intronic
913098453 1:115541322-115541344 GGCAGAGGCCAGCCACCTGTGGG + Intergenic
914255696 1:145960313-145960335 GACTGAGCAGATCCGCCTGCTGG - Exonic
915286603 1:154857336-154857358 GGCTGAGGAAAGTCTCCTGTGGG - Intronic
917969259 1:180196761-180196783 GGCTGAGAAGAACCGCCTCTGGG + Exonic
920095386 1:203483308-203483330 GGCTGAGGAAAGCTGGGTGTGGG - Exonic
922085663 1:222344566-222344588 GGCTGGTGAGAGCTCCCTGTGGG - Intergenic
922819881 1:228476881-228476903 GGCTCAGGAGAGACGCCTCAGGG + Intergenic
923545852 1:234922874-234922896 GGCTGAGGAGAGCCTCCAGTGGG - Intergenic
924052531 1:240092815-240092837 GGCTGAGGGGAGACGGCAGTGGG - Exonic
924715290 1:246566993-246567015 GGGTGGGGAGAGCGGGCTGTGGG - Intronic
1067684265 10:48457582-48457604 CTCTGAGGACAGCCTCCTGTGGG - Intronic
1072783025 10:98262878-98262900 GCCAGAGGAGGGCCGCCTGGAGG - Exonic
1073189772 10:101643071-101643093 GGCTCATGAGAGTCTCCTGTTGG - Intronic
1074317226 10:112370696-112370718 GGCTGAGGAGTGCCGGCTCATGG + Intergenic
1076344116 10:129768835-129768857 GGCTGCAGAGGGCGGCCTGTAGG - Intergenic
1076673600 10:132136400-132136422 GGCTGCGGAGTCCCGGCTGTTGG + Intronic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1077169618 11:1160388-1160410 GGCTGAGGAGATGCTCCTGGAGG + Intronic
1077894505 11:6443553-6443575 GGCTGAGGAAAGAAGCTTGTCGG + Intergenic
1078838960 11:15059863-15059885 GTTTGAGGAGAGCAGCCTGCAGG + Intronic
1079951001 11:26804298-26804320 GGCTGAGGAGAGCCTCTTTCAGG - Intergenic
1081543130 11:44050655-44050677 GGATAAGGACAGCTGCCTGTGGG - Intronic
1081688108 11:45056662-45056684 GGCTGAAGTGAGGCGCCTGGAGG - Intergenic
1081805566 11:45888126-45888148 GGCTGAGGAGAGCCGCCTGTAGG + Intronic
1082205997 11:49434578-49434600 GGCTGAGCAGAGCCGGGCGTTGG - Intergenic
1083774844 11:64889325-64889347 GTGTGAGCAGAGCTGCCTGTGGG + Intergenic
1084249395 11:67884876-67884898 GGCTGAGGAAAGGAGACTGTGGG + Intergenic
1084672646 11:70616347-70616369 GGCTGGGGAGGGCCTCCTCTTGG - Intronic
1086853970 11:91844343-91844365 GACAGAGGAGACCCACCTGTAGG - Intergenic
1089586484 11:119512844-119512866 GGCTGGGGAGAGGAGCCTGTGGG + Intergenic
1090671066 11:128945697-128945719 GGCTGAGTTGAGGGGCCTGTGGG + Intergenic
1091987107 12:4919518-4919540 GGCTGAGCAGAGGTGCCTGGTGG + Intronic
1094818715 12:34209052-34209074 GGCTCACGAGAGCACCCTGTGGG + Intergenic
1096240932 12:49960020-49960042 GGCTGAGGGGAGGAGCCTGCAGG - Intergenic
1096491453 12:52015178-52015200 GGAGGAGGAGAGCCAGCTGTAGG + Exonic
1097277682 12:57824324-57824346 GGAAGAGCAGAGCAGCCTGTTGG + Intronic
1101310232 12:103571621-103571643 CGCGGAGGAATGCCGCCTGTAGG - Intergenic
1102708976 12:114908717-114908739 GGCTGAGAAGAGCCACCTTGAGG - Intergenic
1103709945 12:122905078-122905100 GGCTGAGGAGGGCAGACTGCTGG - Intergenic
1105279364 13:18954303-18954325 GACTCAGGAGGGCCTCCTGTAGG - Intergenic
1105756181 13:23466464-23466486 GGCTGACGGCTGCCGCCTGTGGG + Intergenic
1112399980 13:99068013-99068035 GGCTGTGGAGAACCACATGTGGG - Intronic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1115435743 14:33371061-33371083 GGTTAAGGAGAGCCCACTGTGGG + Intronic
1121405661 14:93717819-93717841 GGCTTTGCAGAGCAGCCTGTGGG + Intergenic
1121436717 14:93925476-93925498 GGCTGAAGAGAGCGCCCTGAGGG - Intronic
1121629127 14:95409822-95409844 GGGTGATGAGGGCCACCTGTGGG + Intronic
1122027277 14:98887021-98887043 GGGTGAGCAGAGCCGGCTGCAGG + Intergenic
1122453397 14:101830441-101830463 GGCTGAGGACAGCCAAGTGTTGG + Intronic
1122780207 14:104140282-104140304 GGCTCAGGCCAGGCGCCTGTGGG + Intronic
1122984805 14:105207148-105207170 GGGTGGGGAGAGCCCCCTGGAGG - Intergenic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1128130907 15:65226482-65226504 GGTTGGGGAGAGCAGGCTGTTGG - Intergenic
1128535624 15:68487877-68487899 GGCTGAGAAGAGGAGGCTGTGGG + Intergenic
1129705424 15:77791486-77791508 GGAGGAGGAGAGTCACCTGTTGG + Intronic
1138289222 16:55832746-55832768 GCCTGAGGTGGGCCGGCTGTCGG + Intronic
1138553808 16:57760881-57760903 GGCCGAGGGCAGCCGCCTGCGGG - Exonic
1138578307 16:57922969-57922991 GGCTGAGGGGAGCTGCCTGCAGG - Intronic
1139220465 16:65176616-65176638 GGCTGAGGGGAGCAGGCTGTTGG - Intergenic
1140526028 16:75623448-75623470 GGATGATGGGAGCCGCTTGTTGG + Intergenic
1141125753 16:81399657-81399679 GGCTGAGAAGAGCCTGCTTTTGG - Intergenic
1141199116 16:81883546-81883568 GGATGAGAAGAGCCTCATGTCGG + Intronic
1142233987 16:88912844-88912866 GGATGAGGGGAGCTGCCTGCTGG - Intronic
1144191520 17:12850861-12850883 GGCTGAGGATAGAAGCCTCTTGG + Intronic
1144624939 17:16839779-16839801 GGCTGTGGGGAGCAGTCTGTGGG - Intergenic
1144881489 17:18432942-18432964 GGCTGTGGGGAGCAGTCTGTGGG + Intergenic
1145150744 17:20511444-20511466 GGCTGTGGGGAGCAGTCTGTGGG - Intergenic
1145948640 17:28798153-28798175 GGCTGAGGTGAGCAGACTGCAGG + Intronic
1146935325 17:36809274-36809296 GGCTGGGGAGAGACCCCTGCTGG - Intergenic
1147587297 17:41659825-41659847 GGGTGAGGAGAGAGGCCTGCTGG - Intergenic
1148555155 17:48574407-48574429 GGCTGGGGACACCGGCCTGTCGG + Intronic
1148757264 17:49980113-49980135 GGCTGGGAAGAGCCAGCTGTAGG - Intergenic
1150697581 17:67419063-67419085 GGCAGAGGACAGCAACCTGTTGG + Intronic
1152290349 17:79436735-79436757 GCCTGTGGATAGCCACCTGTGGG - Intronic
1152555261 17:81049867-81049889 GCCTGAGGAGAGCCCACTGTGGG - Intronic
1152570407 17:81119104-81119126 GGCAGAGGAGAGCCGAGTGCAGG + Intronic
1152648101 17:81479513-81479535 GGCTGGAGTGAGCTGCCTGTGGG - Intergenic
1156742004 18:40342796-40342818 GGCTGAGGAGATACTCCTTTAGG + Intergenic
1157293683 18:46427060-46427082 GGCTGAGGAGAGGCCCCAGGGGG + Intronic
1160930264 19:1567033-1567055 GGCTTAGGGGGGCCGCCTGCAGG - Intronic
1161488497 19:4548649-4548671 GGCTGAGGAGAGCCTGGTTTGGG - Intronic
1161784780 19:6317445-6317467 GGCTGAGAAGAGGCGCATGGAGG - Intronic
1162110584 19:8397704-8397726 GGCAGAGGAGGGCTGCCTGGTGG + Intronic
1162440272 19:10688214-10688236 GGCTGAGGAGAGGCGGCTGCTGG + Intronic
1162902734 19:13805102-13805124 GGCTGATGAGATCCTCCTGCTGG + Exonic
1163284088 19:16335479-16335501 GGCTGCGCAGAGCAGGCTGTGGG - Intergenic
1163443504 19:17333635-17333657 AGCTCAGGAGAGCCGCATCTGGG + Intronic
1165378671 19:35462093-35462115 GGCTGAGGAGGGAGGACTGTTGG + Intergenic
1166560870 19:43731601-43731623 GGCAGAGTACAGCCGCCTGCTGG - Exonic
1167054516 19:47101106-47101128 GGCTCAAGTGATCCGCCTGTTGG - Intronic
1167750832 19:51379316-51379338 GGCTGGGGAGAGCCAACTGGAGG + Intergenic
925073220 2:987731-987753 GGCTGGGGAGAGAGGCCTGGAGG + Intronic
925195955 2:1925977-1925999 TGCTGGGGAGAGCAGCCCGTTGG + Intronic
925734441 2:6948976-6948998 GGCAGAGGAGAGGCACCAGTGGG + Intronic
925900965 2:8509081-8509103 GGCAGAGGAGAGCAGCTTGGGGG - Intergenic
926684046 2:15684923-15684945 GTCTGAGGAGCGGCGCCTGTAGG - Intergenic
933860894 2:86466520-86466542 GGCTGAGTACAGCTGCCTTTTGG - Exonic
934663534 2:96155407-96155429 GGCTGAGCAGAGGGGCCTGGTGG - Intergenic
935105809 2:100042252-100042274 GGCTGCGGAGGGCCCTCTGTGGG - Intronic
935434040 2:103008888-103008910 GGCTGGAGAGACCAGCCTGTGGG + Intergenic
935677689 2:105609803-105609825 GCTTGATGAGAGCTGCCTGTGGG - Intergenic
947447400 2:230174562-230174584 GGCTGAGGAGAACAGCTTTTGGG - Intronic
1170770723 20:19330212-19330234 GGCTGAGGAGGGCCTCCAATCGG + Intronic
1171364069 20:24611640-24611662 GGCTGAGGAGGGGCTCCTGGAGG - Intronic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1172592262 20:36126185-36126207 GGATGAGGAAGGCCTCCTGTGGG + Intronic
1172652352 20:36512828-36512850 GGCTGAGGGAAGCCACCAGTGGG + Intronic
1172836604 20:37877344-37877366 GGGTGAGGAGAGCAGACTGGTGG - Intergenic
1174208143 20:48856228-48856250 GGGTGAGGACAGCGGCCTGCTGG + Intergenic
1179334421 21:40437170-40437192 TTCTGAAGAAAGCCGCCTGTAGG - Intronic
1179396388 21:41044007-41044029 GGCTCAGCAGAGCTGCCTGAGGG - Intergenic
1180003232 21:45004553-45004575 GGCACAGGAGCGCCGGCTGTGGG - Intergenic
1180231998 21:46432211-46432233 AGCTGGTGAGAGCCGCCTGCCGG + Exonic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180784286 22:18538335-18538357 GACTGAGGAGAGCAGGGTGTGGG + Intergenic
1181127857 22:20712388-20712410 GACTGAGGAGAGCAGGGTGTGGG + Intronic
1181241189 22:21477692-21477714 GACTGAGGAGAGCAGGGTGTGGG + Intergenic
1181515030 22:23405372-23405394 GGCTGGGCTGAGCCGCTTGTGGG + Intergenic
1182501957 22:30754477-30754499 GGCTGAGGAGAGACTCATGTGGG + Intronic
1184664689 22:45982063-45982085 GGCTGAGAGGAGCTGACTGTGGG + Intergenic
1184940587 22:47761958-47761980 GGCTGGGGAGAGCCATTTGTTGG - Intergenic
953103359 3:39851965-39851987 GACTGAGGAGAGCCATTTGTGGG + Intronic
953882921 3:46700941-46700963 GGGTGACCAGAGCCGCCTCTGGG + Intergenic
959955329 3:112231367-112231389 TGCTGACAAGAGACGCCTGTTGG + Exonic
960331874 3:116369830-116369852 GGATGAGAAGAGCCACCAGTGGG + Intronic
961298284 3:125904263-125904285 GGCTGAGGAGTGCCGGCGCTGGG + Intergenic
962786570 3:138773811-138773833 GGGTGAGGAGAGAAGACTGTGGG - Intronic
966222168 3:177561537-177561559 GGGTGAAGAAAGCCCCCTGTTGG + Intergenic
967198413 3:187049544-187049566 AGCTGAGGAGGGACACCTGTCGG - Intronic
967412300 3:189179338-189179360 GGGTGAGGAGAGCCACCACTGGG - Intronic
968263487 3:197343854-197343876 GGCCATGGAGAGCCGCCTCTGGG - Intergenic
968460360 4:721689-721711 GGGTGTGGAGAGAGGCCTGTGGG + Intronic
968913315 4:3486489-3486511 GGCAGAGGCGAGCAGCATGTGGG + Intronic
969521007 4:7677815-7677837 GGTGGAGGAGGGCCGCCTGCAGG - Intronic
969631709 4:8342890-8342912 GGCTCAGGAGGGCCCCCTGGAGG + Intergenic
971518824 4:27523090-27523112 GTCTGAGGAGAGTTGCCTGATGG + Intergenic
982775594 4:159438343-159438365 GGCTGAGTGGAGATGCCTGTTGG + Intergenic
984429155 4:179626141-179626163 GGCTGAGGAGGGACGACTGCTGG - Intergenic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985745915 5:1647665-1647687 GGCTGGAGAGAGGCGCCCGTGGG - Intergenic
993904165 5:93604496-93604518 GGCTGAGGGGGGCCGGCTGGTGG + Intergenic
999051130 5:148524890-148524912 GAATGAGGAGAGCCCCGTGTTGG + Intronic
999538147 5:152541374-152541396 GGCTGAGGAGTGCTGTATGTTGG + Intergenic
1002169745 5:177368260-177368282 ATCTGAGGTGAGCCGACTGTTGG + Exonic
1002542118 5:179913255-179913277 GGCTGTGGAGTTCCTCCTGTTGG - Intronic
1003381846 6:5631642-5631664 GGCTGAGTGAAGCTGCCTGTGGG - Intronic
1005956374 6:30666160-30666182 GGCTGAAGATTGCCTCCTGTTGG - Intronic
1006386397 6:33733431-33733453 GGATGAGGACAGCCTCCTGAAGG + Intronic
1006439378 6:34043644-34043666 GGCTGAGGCCAGCCTCCTGGGGG - Intronic
1006558551 6:34889473-34889495 GCCTGAGGAGAGCCGCTTCCCGG - Exonic
1006582745 6:35086190-35086212 GGCTGCAGAGAGCGGCCTGCAGG + Intronic
1008286622 6:49660648-49660670 GGCTCAGGAAAGCTGCCTGGGGG - Intergenic
1009402631 6:63274972-63274994 GGCTGAGGAGTGCCCGCTGGTGG - Intergenic
1012318834 6:97816683-97816705 GAATGAGGAGAGCCCCATGTGGG + Intergenic
1012533439 6:100266713-100266735 GGCTGAGGAGTGCCTTCTGCAGG + Intergenic
1017804847 6:157935776-157935798 GGCTGGCGAGAGCTGCCAGTGGG + Intronic
1017890132 6:158631087-158631109 GGCTGAGGGAGGCGGCCTGTGGG - Intronic
1019432853 7:1007424-1007446 GGCTGAGGACACTCCCCTGTGGG + Intronic
1019607511 7:1917497-1917519 GGCTCAGGGGAAGCGCCTGTTGG + Intronic
1024527738 7:50363053-50363075 GGTAGAGGCGAGCCCCCTGTGGG + Intronic
1024587197 7:50852103-50852125 GGCTGAGGGAAGCCTCCTGCAGG + Intergenic
1026360205 7:69597154-69597176 GGCTGCTGAGAGCGGGCTGTCGG + Intergenic
1026867196 7:73831146-73831168 GGCTGAGGGGATCCGGCTGTGGG - Exonic
1028891314 7:95991497-95991519 GGATAAGGACAGCAGCCTGTTGG - Intronic
1029537016 7:101163049-101163071 GGCGGAGGAGCGCCGGCTGCAGG - Exonic
1029734583 7:102458466-102458488 GGCTGAGGTGAGAGGACTGTTGG + Intronic
1030989732 7:116286028-116286050 GGCTGAGCAGAGGGGCATGTTGG - Intergenic
1033433164 7:141307509-141307531 GTCTGATGGGAGCCTCCTGTTGG - Intronic
1035039483 7:155917097-155917119 TGCTGAGGAGAGGGGCCCGTTGG - Intergenic
1035813906 8:2517495-2517517 GGCTGGGGAGTGGCTCCTGTGGG - Intergenic
1037132376 8:15422741-15422763 GGCTGAGGTGGGGCGCCTGGGGG - Intronic
1040079635 8:43274345-43274367 GGCTGAGGAGGGTCCCCTCTGGG - Intergenic
1042553176 8:70012290-70012312 GGCAGAGGAGAGACGTGTGTTGG - Intergenic
1046766472 8:118074924-118074946 GGGAGAGGAGAGCCGGCTGTGGG + Intronic
1049321499 8:141999324-141999346 GGCTGAGGGGAGCTCCCTGGGGG - Intergenic
1049335267 8:142081099-142081121 GGATGAGGAGGGCCGCGTGGTGG - Intergenic
1049544177 8:143221800-143221822 GGCTGGGGAGGACCGGCTGTTGG - Intergenic
1049818902 8:144622259-144622281 GGCTGAGGTGAGCTGCCTCTGGG + Intergenic
1050529327 9:6574673-6574695 GGATGAGGAGAGCCGTCTTTCGG - Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1054159203 9:61661906-61661928 GGCTGAGCAGAGTCGCCAGCCGG - Intronic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054478977 9:65592911-65592933 GGCTGAGCAGAGTCGCCAGCCGG - Intergenic
1056246215 9:84697666-84697688 GGCTGTGGAGATCCTCCTGGAGG + Intronic
1058533076 9:105926115-105926137 GACTGAGGACAGGAGCCTGTGGG + Intergenic
1059658748 9:116380552-116380574 GCCTCAGGAGATCTGCCTGTGGG - Intronic
1060186091 9:121565003-121565025 GGCTGCGGGGAGCCGCTTGCAGG + Intergenic
1061238005 9:129353176-129353198 GGCTGAGCAGACCTGCGTGTTGG - Intergenic
1061280087 9:129592994-129593016 GGTTGAAGAGAGTCCCCTGTGGG + Intergenic
1061799795 9:133107507-133107529 GGCAGGCGTGAGCCGCCTGTTGG - Intronic
1062106211 9:134756442-134756464 GGCAGAGGAGACCCGGCTGGAGG - Intronic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1190108467 X:47574575-47574597 GGCTGTGGAGGGCCGCCTGGGGG + Exonic
1190253223 X:48743216-48743238 GCCTCAGGAGATCCGCCTCTCGG - Intergenic
1192251473 X:69417139-69417161 GGTTGAGGAGTGCCGCGTATGGG + Intergenic
1196234435 X:113262104-113262126 GGCTCAGGAGATCCCCTTGTGGG - Intergenic
1200344540 X:155435553-155435575 GGCTGGACAGAGCCCCCTGTGGG + Intergenic
1200836856 Y:7740624-7740646 GGCTGTGGGGAGCTGCCTGTGGG - Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic