ID: 1081806198

View in Genome Browser
Species Human (GRCh38)
Location 11:45892157-45892179
Sequence CCCCATGTTCACCCAGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 246}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081806191_1081806198 0 Left 1081806191 11:45892134-45892156 CCCAAAGAACAAACCCAGCCCAA 0: 1
1: 0
2: 1
3: 27
4: 276
Right 1081806198 11:45892157-45892179 CCCCATGTTCACCCAGAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 246
1081806192_1081806198 -1 Left 1081806192 11:45892135-45892157 CCAAAGAACAAACCCAGCCCAAC 0: 1
1: 0
2: 1
3: 24
4: 216
Right 1081806198 11:45892157-45892179 CCCCATGTTCACCCAGAGCCAGG 0: 1
1: 0
2: 1
3: 24
4: 246

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081806198 Original CRISPR CCCCATGTTCACCCAGAGCC AGG Intronic
900208087 1:1440013-1440035 CCCCATCCCCGCCCAGAGCCGGG + Exonic
900385017 1:2406564-2406586 CCCCCTGTGCACCCTGTGCCTGG - Exonic
900494586 1:2970766-2970788 AGCCATGTCCACCCAGGGCCCGG - Intergenic
901225119 1:7608845-7608867 GCCCCTGTTCAGCCAGAGACTGG - Intronic
901767969 1:11515777-11515799 CCCCAACCTCACCCAGAGCTAGG - Intronic
902863173 1:19260352-19260374 CACCATGTTCACCCAGGCCTAGG + Intergenic
904093113 1:27958884-27958906 GCCCAGGATCACCCAGAGCTGGG + Exonic
904255439 1:29251670-29251692 CCTCTTGTTCATCCTGAGCCAGG - Intronic
904269675 1:29341683-29341705 CACCATGTTCACACAGAAACTGG - Intergenic
905271676 1:36791569-36791591 CTGCATGTTCTCCCAGAACCTGG + Intergenic
906093648 1:43204782-43204804 CATCATGTTCAGCCAGAGACTGG + Intronic
906531124 1:46524660-46524682 CCCCATCTGCACCCCCAGCCAGG - Intergenic
907501310 1:54883578-54883600 CCCCACCTGCTCCCAGAGCCCGG + Intronic
911216506 1:95200915-95200937 CCCCATGCTCATCCAGCTCCAGG + Intronic
912467414 1:109883540-109883562 CCCCATGCACACCCAGGGCTGGG + Intergenic
912546963 1:110457800-110457822 CTCCATCTTAACCCAGAGGCTGG + Intergenic
916924941 1:169508743-169508765 ACCCAAGTTCACCCATAGCAAGG + Intergenic
917978440 1:180254711-180254733 CCCCAAGTTCACGCTGAGCCTGG - Intronic
920421831 1:205840064-205840086 CCCCATGTTTACCCAAACCCAGG + Intronic
921338091 1:214108046-214108068 CCCCACCTCCTCCCAGAGCCAGG + Intergenic
923010638 1:230084870-230084892 TCCCATGTTCACCCTGCACCAGG - Intronic
1062932179 10:1360635-1360657 CCCCATGCACACCCACAGCTGGG - Intronic
1063115457 10:3068670-3068692 CCCCACGTGCACCCGGGGCCTGG - Intronic
1063915592 10:10878845-10878867 CCTGATCTTCACCCAGAGCTTGG - Intergenic
1066084602 10:31963746-31963768 GCCTATGTTCACTCACAGCCTGG - Intergenic
1066986268 10:42470187-42470209 CTCCATGCATACCCAGAGCCCGG - Intergenic
1070641974 10:78176881-78176903 GCCATTGTTCAGCCAGAGCCAGG + Intergenic
1071529208 10:86376624-86376646 CCTAATGTGGACCCAGAGCCTGG + Intergenic
1075097066 10:119479136-119479158 CACGGTGTTCACACAGAGCCAGG - Intergenic
1075924817 10:126242801-126242823 CACCATGTGAACCCAGAGCTGGG - Intronic
1076858614 10:133129262-133129284 CCCCATGGTCACCCAGCCCGAGG + Exonic
1077215118 11:1392148-1392170 CCCCATGTCCACCCAACTCCTGG - Intronic
1077253945 11:1572397-1572419 CCTCAGCTTCACCCCGAGCCCGG - Intergenic
1078002577 11:7509792-7509814 GCCCATGCTCATCCACAGCCAGG - Exonic
1079532285 11:21468783-21468805 GCATATGTTCACCCAGAGACAGG + Intronic
1080000378 11:27341788-27341810 ACCAATGTCCACTCAGAGCCTGG + Intronic
1081380550 11:42409358-42409380 TCCCATGAGCACCAAGAGCCAGG + Intergenic
1081806198 11:45892157-45892179 CCCCATGTTCACCCAGAGCCAGG + Intronic
1082076508 11:47980122-47980144 CCCCAAGCCCACCCAGGGCCAGG + Intergenic
1083158864 11:60842365-60842387 CCCCAAGGGCAGCCAGAGCCAGG + Exonic
1083276372 11:61599296-61599318 CAGCTTGTTCACTCAGAGCCAGG - Intergenic
1083994541 11:66265610-66265632 CTCCATGTTCCCCCAGACCCAGG - Intronic
1084303112 11:68264265-68264287 CCCCATGTGCACCCTGTGACAGG + Intronic
1084467424 11:69334201-69334223 CCCCAAGTTCCCCCATACCCTGG + Intronic
1084642500 11:70434212-70434234 CCCCGTGTTCCCTCAGGGCCAGG + Intronic
1084935706 11:72585510-72585532 CCCCATGCCCACACACAGCCAGG + Intronic
1087659062 11:100964463-100964485 CCTCATGTTTAGCCTGAGCCAGG + Intronic
1089681500 11:120121446-120121468 CCCCAACTCCACCCTGAGCCTGG + Intronic
1089764257 11:120751557-120751579 CCCCAAACCCACCCAGAGCCTGG - Intronic
1089978500 11:122753250-122753272 CACCATGTTGACCAGGAGCCAGG - Intronic
1090807824 11:130213377-130213399 TTCCATGCTCACCCTGAGCCAGG - Intergenic
1092108972 12:5945521-5945543 CTCCCTGCTCCCCCAGAGCCGGG + Intronic
1092171009 12:6374143-6374165 CCCCAGGCTCACCCAGAGTGTGG - Intronic
1094321748 12:29191270-29191292 CCCCATCTCTACCCTGAGCCAGG + Intronic
1096171983 12:49479114-49479136 CCCCAGGCTCAGCCAGAGCTGGG - Intronic
1099488275 12:83254854-83254876 CCCTATCCTGACCCAGAGCCAGG + Intergenic
1101042202 12:100767965-100767987 CCCCATGTTCCACTAGATCCAGG - Intronic
1101086271 12:101239537-101239559 CCCCAGGCTCAGCCAGAGCAGGG + Intergenic
1106136047 13:26974504-26974526 CACCATGTTCTGCCTGAGCCCGG + Intergenic
1109206999 13:59493525-59493547 CCCCATGTTCTACCTCAGCCAGG + Intergenic
1110600911 13:77372693-77372715 TCCCATGTTCACCTTGAGGCAGG - Intergenic
1110810681 13:79807999-79808021 CCCCAGGCTCAGCCAGAGCAAGG + Intergenic
1111913456 13:94337197-94337219 CCCCATGTGAACCCAGATCCAGG - Intronic
1112494230 13:99893169-99893191 CCCCATCCTCACTCAGAGGCCGG + Exonic
1112639661 13:101258529-101258551 CCACATGTTCATCCTGAGCATGG - Exonic
1113666295 13:112143839-112143861 CCCCATGTACTCACAGACCCTGG - Intergenic
1113793017 13:113040727-113040749 CACCACGTTCCCCCAGTGCCTGG - Intronic
1113854006 13:113434264-113434286 ACCTATGTTCACCCTGCGCCTGG - Intronic
1113854492 13:113436154-113436176 ACCTATGTTCACCCTGCGCCTGG - Intronic
1113854596 13:113436532-113436554 ACCTATGTTCACCCTGCGCCTGG - Intronic
1113854687 13:113436826-113436848 ACCTATGTTCACCCTGCGCCTGG - Intronic
1113854739 13:113437036-113437058 ACCTATGTTCACCCTGCGCCTGG - Intronic
1113922077 13:113918835-113918857 CGCCTTGCTCACCCAGAGCACGG - Intergenic
1114516966 14:23306755-23306777 CCCCATCATCACCCGGCGCCGGG + Exonic
1118025371 14:61762843-61762865 TCCCATCTCCACCCTGAGCCAGG + Intronic
1118832344 14:69446298-69446320 CCCCATCTTCAGACAGAGCTAGG - Intronic
1121695330 14:95907916-95907938 CCCCAGGTTCAGCCAGAGCAGGG - Intergenic
1122288796 14:100668494-100668516 CCCCATGTACACACAGTCCCAGG + Intergenic
1202898067 14_GL000194v1_random:21425-21447 CCGTGTGTTCACCCGGAGCCTGG - Intergenic
1124258476 15:28165155-28165177 CTCCATGTTGACCCAGAGTGTGG - Intronic
1125018972 15:34966623-34966645 CCCCATGTACTCCCAGCACCTGG + Intronic
1126751148 15:51877845-51877867 GCCCATGTTCATGCAGAGCTGGG - Intronic
1127367978 15:58309424-58309446 CCTCAGGTTCCCCCAGAACCTGG + Intronic
1127650171 15:60999294-60999316 CCCCATGTTCAAATGGAGCCTGG - Intronic
1130183188 15:81651877-81651899 CCCCAGGCTCAGCCAGAGCTGGG + Intergenic
1132095870 15:98984435-98984457 CCCCATCTCCACCAAGGGCCCGG - Intronic
1132499130 16:276914-276936 CCCCAGGTGCACCCCGAGCCAGG + Intronic
1132627492 16:898482-898504 CCTCAAGGACACCCAGAGCCGGG - Intronic
1132709674 16:1260799-1260821 ACGCATGTCCACACAGAGCCCGG + Intergenic
1132839823 16:1973599-1973621 CCCCAGGCTTGCCCAGAGCCCGG - Intronic
1132859433 16:2062724-2062746 GCACCTGCTCACCCAGAGCCAGG - Intronic
1133998897 16:10767268-10767290 GACCATGTTATCCCAGAGCCAGG - Exonic
1134765862 16:16757355-16757377 CCCCATCTTCACCATGAGCCTGG - Intergenic
1134980188 16:18601859-18601881 CCCCATCTTCACCATGAGCCTGG + Intergenic
1136355404 16:29741937-29741959 CACGAAGTTCACCCACAGCCAGG - Intergenic
1137468519 16:48733078-48733100 GCCCAAGGTCACCCAGAGCCTGG - Intergenic
1137674802 16:50298986-50299008 CCCCATCTTCACGCAGTTCCGGG - Exonic
1137825247 16:51489368-51489390 CCCCAGGTTCAGCCAGAGCAGGG - Intergenic
1137880352 16:52039463-52039485 CCCCACTTTCACCCAGACCTAGG + Intronic
1138383386 16:56618894-56618916 TCACATGTCCATCCAGAGCCTGG - Intergenic
1141714988 16:85721773-85721795 CCCCATGTGGTCCCAGTGCCTGG + Intronic
1142337878 16:89502027-89502049 CTCCATGTCCACACTGAGCCTGG + Intronic
1143603798 17:7968724-7968746 CCCCAAATTCCCCCACAGCCGGG + Intergenic
1144753558 17:17666413-17666435 CCTCATGTCCATCCAGAGCTGGG - Intergenic
1144958772 17:19033142-19033164 CCCCACATTCACCCTGAGCCCGG - Intronic
1144976387 17:19141382-19141404 CCCCACATTCACCCTGAGCCCGG + Intronic
1145303100 17:21654276-21654298 CCTGGTGTTCACCTAGAGCCTGG - Intergenic
1146446660 17:32937548-32937570 CCCAGTGCCCACCCAGAGCCTGG - Intronic
1146461617 17:33050386-33050408 GGCCATGGTCATCCAGAGCCAGG - Intronic
1148856663 17:50582695-50582717 CCCCACCATGACCCAGAGCCAGG - Intronic
1149085481 17:52710373-52710395 CCCCAGGCTCAGCCAGAGCAGGG + Intergenic
1149104158 17:52942433-52942455 CCCCATGTTCAACTAGGGACTGG + Intergenic
1149422756 17:56527263-56527285 CCCTATGTTCAACCAGAAGCAGG + Intergenic
1151368160 17:73630483-73630505 CCCCAGGTTCCCCCAGGGCCTGG + Intronic
1151600324 17:75102168-75102190 CCCCATGCACACCCAGAGGCTGG - Intronic
1151743753 17:76000918-76000940 CGCCATGTGTACCCAGAGCCTGG + Exonic
1152027467 17:77821179-77821201 CCCAGAGGTCACCCAGAGCCTGG - Intergenic
1152459318 17:80432938-80432960 CCCCAGACACACCCAGAGCCTGG + Intronic
1152474988 17:80512203-80512225 CCCATTCTCCACCCAGAGCCAGG - Intergenic
1154207192 18:12347315-12347337 CCCCAGTTTCATCCTGAGCCTGG + Intronic
1155635041 18:27942699-27942721 CTACATGTTCCCCCAGAGCCCGG + Intergenic
1157232607 18:45932961-45932983 CCACATGCTAACACAGAGCCTGG + Intronic
1157576946 18:48749949-48749971 CACCAGGTTCACGCGGAGCCTGG + Intronic
1157694357 18:49708924-49708946 GCCCATGTTTCCCCAGAGTCAGG - Intergenic
1159952584 18:74496194-74496216 CCCCATTTCCGCCCTGAGCCAGG - Exonic
1160148199 18:76380920-76380942 CCCCAAGGTCCCCCAGAGGCGGG + Intronic
1160518282 18:79490252-79490274 CCCCACCCTAACCCAGAGCCGGG - Intronic
1160518319 18:79490371-79490393 CCCCATCCTGACCCAGAGCCTGG - Intronic
1161824138 19:6551330-6551352 CCCCAGGCTCAGCCAGAGCAGGG - Intergenic
1162020127 19:7864533-7864555 CCCCACCCTCAGCCAGAGCCAGG + Intronic
1162418573 19:10552917-10552939 CCCCATGTTCACCCTGGCCGAGG + Exonic
1162511777 19:11123367-11123389 GCCCCTCTTCACCCAGAGACGGG + Intronic
1163429676 19:17259760-17259782 CCCAATTGTCACCAAGAGCCTGG + Intronic
1163802877 19:19377982-19378004 CCACATGATTTCCCAGAGCCAGG + Intergenic
1163846355 19:19640377-19640399 CCCCAGCTAGACCCAGAGCCCGG - Intronic
1164760319 19:30723624-30723646 CCCCATGGTCAGGCAGAGCATGG + Intergenic
1165742395 19:38211779-38211801 CCCCATGCCCGCCCAGAGGCGGG + Exonic
1168350992 19:55675398-55675420 CGCCATGACCCCCCAGAGCCCGG + Intronic
925446010 2:3927707-3927729 CTCCCTGTGCACCTAGAGCCTGG + Intergenic
925922674 2:8647704-8647726 CCCCAGGCTCAGCCAGAGCAGGG + Intergenic
927826396 2:26312732-26312754 CCCCATGTGCTCCCAGCGCCAGG + Intronic
927948605 2:27152502-27152524 TCTCCTGATCACCCAGAGCCTGG - Intronic
928245682 2:29624892-29624914 CCCCATTCTCACCCAGCACCAGG - Intronic
929190086 2:39131722-39131744 CGTCATGTTCACCGAGGGCCTGG + Intergenic
929578770 2:43068947-43068969 CCCCCTGGCCACCCACAGCCTGG + Intergenic
931459969 2:62442049-62442071 CCACATGCACAGCCAGAGCCTGG - Intergenic
931668715 2:64627902-64627924 GCCCAAGGTCACACAGAGCCAGG + Intergenic
932337612 2:70939896-70939918 CGATGTGTTCACCCAGAGCCAGG + Exonic
934976156 2:98803927-98803949 CCCCATGTGTCCCCAGGGCCTGG - Intronic
935132892 2:100274650-100274672 CACCCTGATCACCCAGGGCCAGG + Exonic
936289967 2:111215912-111215934 CCCCAGGCTCAGCCAGAGCAGGG - Intergenic
936290069 2:111216595-111216617 CCCCAGGCTCAGCCAGAGCAGGG - Intergenic
937854250 2:126661102-126661124 TCCCATGTGCAGGCAGAGCCAGG + Intronic
938106036 2:128530388-128530410 CCCCATGCCCACCCTGTGCCAGG - Intergenic
938232703 2:129675342-129675364 CCCCACTCTCACCCAGGGCCTGG - Intergenic
940485588 2:154291609-154291631 ACCCATGCCCACCCAGAACCCGG + Intronic
941451916 2:165670284-165670306 CCCCATGTTCACCCTAAGCTAGG + Intronic
945972251 2:216242399-216242421 CACCGTGTTTTCCCAGAGCCAGG + Intergenic
946467502 2:219925068-219925090 CCCCATGTTGGCTCAGAGCATGG - Intergenic
947708038 2:232292483-232292505 TCCCATGTTCCCACAGAGTCTGG + Intronic
1170998643 20:21391630-21391652 CCCCACGTGCACCGAGGGCCTGG - Intergenic
1172488400 20:35314360-35314382 CCCCATGTGCTCCCAGAGAGAGG - Intronic
1172885564 20:38228599-38228621 AGCCAAGTTCCCCCAGAGCCTGG + Intronic
1174987259 20:55469044-55469066 TCCCAGGTTAACTCAGAGCCAGG + Intergenic
1175273198 20:57749203-57749225 CCCCAAGTCCACCTAGAGCAGGG - Intergenic
1176105677 20:63384723-63384745 CCCCGTGTTCCCACAGGGCCGGG + Intergenic
1176408430 21:6434413-6434435 CCCCAGGCTCAGCCAGAGCTGGG + Intergenic
1176617746 21:9037414-9037436 CCGTGTGTTCACCCGGAGCCTGG - Intergenic
1179683923 21:43042739-43042761 CCCCAGGCTCAGCCAGAGCTGGG + Intergenic
1180200876 21:46223371-46223393 AGCCATGTGCCCCCAGAGCCTGG + Intronic
1181068176 22:20316364-20316386 CCCCACTGTCACCCAGGGCCGGG + Intronic
1181488535 22:23246960-23246982 CCCCACGCTCATCCATAGCCTGG - Intronic
1181732730 22:24859407-24859429 CCCCAGGTTCCTTCAGAGCCAGG - Intronic
1182003544 22:26940452-26940474 TCCCAGTTTCACCCATAGCCTGG - Intergenic
1183738200 22:39655390-39655412 CACCAAGTTCAGCCAGAGGCAGG - Intronic
1184097930 22:42326558-42326580 CCCCATCCTTACCCAGAACCTGG - Intronic
1184971816 22:48027839-48027861 CCCCATGTGCTCTCAGAGTCGGG + Intergenic
1185063254 22:48618054-48618076 CTCCGTGTCCACACAGAGCCTGG - Intronic
1185188203 22:49415881-49415903 CCCCAGGTGCGCCCAGAGCTTGG + Intronic
949796335 3:7855306-7855328 CCCCATATTCACCCAAAGCCTGG - Intergenic
950095379 3:10326409-10326431 CTCCATGTTCATTCGGAGCCAGG - Exonic
950372670 3:12544309-12544331 ACCCATGCTCACCTAAAGCCTGG + Intronic
950447621 3:13047401-13047423 GCCCATCTGCACCCAGAGGCAGG - Intronic
951556908 3:23930128-23930150 CCCCATGTTCTTCCAGATCTGGG - Intronic
953546238 3:43865557-43865579 CACCATGTTCCCCCATAACCAGG + Intergenic
953866478 3:46587416-46587438 CCCCAGTATCAGCCAGAGCCTGG + Intronic
954643893 3:52118903-52118925 CCAGATATTCTCCCAGAGCCAGG + Intronic
955619800 3:60850618-60850640 CCACTTGTTTATCCAGAGCCAGG + Intronic
956462286 3:69484794-69484816 CCTCAGGTTCAGCCAGAGCAGGG - Intronic
956696151 3:71921052-71921074 CCCCTTGTTCCCCCAGACCCAGG + Intergenic
961269682 3:125679861-125679883 CCTGATGTTCACCTGGAGCCTGG - Intergenic
963747445 3:149139374-149139396 CCCAATGTTAACACACAGCCTGG - Intronic
967224348 3:187276549-187276571 CCCCATGTGCACCCACACCTGGG + Intronic
967858128 3:194133871-194133893 GCCCAAGGTCACCCAGAGTCAGG + Intergenic
968725760 4:2247176-2247198 CCCCACCTTCACCCAGCTCCAGG + Intergenic
968831020 4:2933076-2933098 CCCCATGGGCACCCAGGCCCAGG + Intronic
968952228 4:3701173-3701195 GCCCCTGTTTACCCAGGGCCAGG + Intergenic
969668435 4:8575609-8575631 CCCAAGGGTCCCCCAGAGCCTGG + Intronic
969703719 4:8781147-8781169 CCCCACCTTCACCCAGACCGGGG - Intergenic
972072582 4:35039084-35039106 CCCCAGGCTCAGCCAGAGCAGGG + Intergenic
972645855 4:40967051-40967073 CCCCAGGTTCAGCCAGACTCAGG + Intronic
980750055 4:137076929-137076951 CCCCAGGTTCATGCAGAGCAGGG - Intergenic
981073446 4:140568724-140568746 CCCCATCTTCACTCAGAGACTGG + Exonic
985544729 5:503934-503956 TCCCATCTTCACCCGGTGCCTGG + Intronic
985602131 5:840947-840969 CCCCTTGCTCACTAAGAGCCAGG + Intronic
985627586 5:997864-997886 GCCCCTGTTGCCCCAGAGCCAGG - Intergenic
985937371 5:3107258-3107280 CCACAGTTCCACCCAGAGCCAGG + Intergenic
989492279 5:42072000-42072022 CCACATGTTCAGCCATATCCAGG - Intergenic
991302618 5:65144225-65144247 CCCCAACTTCTCCCTGAGCCAGG - Intergenic
991437942 5:66615385-66615407 CCTCATGGTCACCCACAGGCCGG - Intronic
995476578 5:112554270-112554292 CCACATGTGCACCAAGACCCAGG + Intergenic
997363875 5:133312978-133313000 CCCCAGGTTCACACAGTGCTTGG + Intronic
997435076 5:133868038-133868060 CCTCAAGTACAGCCAGAGCCTGG + Intergenic
998147578 5:139739024-139739046 CACCATGTGCACCCAGCGCAGGG - Intergenic
1001121358 5:168983295-168983317 CCCCAAGATCACCTAAAGCCAGG + Intronic
1001254445 5:170172621-170172643 CCCCATCTTCACACAGAGTAGGG + Intergenic
1001907749 5:175487126-175487148 CCTCATGTACAGCCACAGCCTGG + Intronic
1002865274 6:1116239-1116261 TCCCTGCTTCACCCAGAGCCTGG + Intergenic
1006298095 6:33178967-33178989 TCCCTTGTTCTCCCAGGGCCGGG - Exonic
1006807558 6:36798385-36798407 CCCCAGGCTCACCCAGAGGATGG + Intronic
1009610144 6:65930933-65930955 CCCCACGCTCAGCCAGAGCTGGG - Intergenic
1010141915 6:72622230-72622252 GCCGCTCTTCACCCAGAGCCCGG - Exonic
1018924265 6:168195402-168195424 CCCAAGGTCCACCCTGAGCCTGG - Intergenic
1019432700 7:1006872-1006894 CCCCAGCTTCACACAAAGCCAGG + Intronic
1019610839 7:1935939-1935961 CCCCAGGTCCCCCCAGAACCAGG + Intronic
1020136011 7:5588455-5588477 CAGCATGGTCAGCCAGAGCCCGG - Intergenic
1020427644 7:8087237-8087259 CCTCATGTTCACCCATGTCCAGG - Exonic
1022466220 7:30654802-30654824 CCACATGTGCACTCAGAGCTGGG - Intronic
1023567899 7:41541656-41541678 CCCCATGTACACCCTCTGCCTGG + Intergenic
1024413175 7:49070884-49070906 CGCCCTGATCACCCAGGGCCAGG + Intergenic
1026157029 7:67835165-67835187 CCACATGTTCCCTCAGAGGCCGG - Intergenic
1026264803 7:68786919-68786941 TCTCATGGGCACCCAGAGCCTGG - Intergenic
1027259622 7:76455527-76455549 CCCCCAGCTCACCCAGAGCAAGG + Intergenic
1027282852 7:76621367-76621389 CCCCCAGCTCACCCAGAGCAAGG - Intronic
1027310992 7:76953615-76953637 CCCCCAGCTCACCCAGAGCAAGG + Intergenic
1027858133 7:83539192-83539214 CCCCCTGGGCTCCCAGAGCCTGG - Intronic
1032463187 7:132126743-132126765 CCCCTTGTGCACCCGCAGCCTGG - Exonic
1034269844 7:149798167-149798189 CCACCTGTTCTTCCAGAGCCAGG + Intergenic
1034385310 7:150736202-150736224 CCCTATTTTCACACAGAGACTGG - Intronic
1034934509 7:155190122-155190144 GCCCAAGATCACACAGAGCCAGG - Intergenic
1034964093 7:155381220-155381242 CCCCGTGTGGACCCAGAGCCAGG - Intergenic
1034977340 7:155456188-155456210 CCCCAAGTTCACTCAGGGCCTGG + Intergenic
1035166437 7:156993175-156993197 CCCCATCTTCACGCGGAGACAGG + Intergenic
1035261022 7:157661726-157661748 CCCCATGCTGCCCCTGAGCCTGG + Intronic
1035262184 7:157669117-157669139 CCCCAGATGCACCCAGACCCCGG - Intronic
1035723646 8:1811973-1811995 CCCCAGGTTCACGCAGGCCCAGG + Intergenic
1035745920 8:1962060-1962082 CCCCATGCTCCCCCAGGGGCCGG - Intergenic
1037504503 8:19516726-19516748 CCCCCAGCCCACCCAGAGCCTGG - Intronic
1037938270 8:22929666-22929688 CCACAGGTTCAACCAGAGCCTGG - Intronic
1040067702 8:43161626-43161648 CCCCATGTCCATCCAGTGCTAGG + Intronic
1040468858 8:47719619-47719641 CCCCTTGTTAGCCCAGTGCCTGG - Intronic
1041565116 8:59268400-59268422 ACCCATGGTCACACAGAGACTGG + Intergenic
1044115208 8:88327319-88327341 CTGCAGGTTCACCCACAGCCGGG + Exonic
1044715986 8:95099944-95099966 GCGCATGTTCTCCCAAAGCCTGG - Intronic
1044962370 8:97543103-97543125 CCCCAGGCTCAGCCAGAGCAGGG + Intergenic
1046092489 8:109519900-109519922 ACCCAGGTTTACACAGAGCCTGG - Intronic
1046858976 8:119068871-119068893 CCTCTTCTTCATCCAGAGCCTGG + Intronic
1047403902 8:124569041-124569063 TCCCATGGGCCCCCAGAGCCAGG - Intronic
1047514570 8:125542506-125542528 CCCGATGTACCCTCAGAGCCTGG - Intergenic
1049303824 8:141886829-141886851 CTCCATGATTAGCCAGAGCCTGG + Intergenic
1049574980 8:143385778-143385800 CCCCATGCCCACGCGGAGCCAGG + Intergenic
1050514686 9:6430641-6430663 CGCCCTGATCACCCACAGCCAGG + Intronic
1053062968 9:35045672-35045694 CCCCAGGATCAGCCAGAGGCAGG + Exonic
1058387878 9:104460182-104460204 CCCCTTGTTCACTCAGCTCCAGG - Intergenic
1060221558 9:121766695-121766717 CGCCAAGGTCACCCAGAACCTGG + Exonic
1060255232 9:122021492-122021514 CCTGGTGTTCACACAGAGCCAGG + Intronic
1062024254 9:134333035-134333057 CCCCTACTTCATCCAGAGCCTGG - Intronic
1062316538 9:135970072-135970094 CCCCACACTCACCCAGTGCCAGG + Intergenic
1192552884 X:72068178-72068200 CCCAACGCTCACACAGAGCCTGG + Intergenic
1197693182 X:129523626-129523648 CCCCTTCCCCACCCAGAGCCCGG + Intergenic
1198496585 X:137199404-137199426 CCCCATCTCTACCCTGAGCCAGG - Intergenic
1200301319 X:154979545-154979567 CCCCACCTTCACCAAGAGCAGGG - Intronic