ID: 1081806225

View in Genome Browser
Species Human (GRCh38)
Location 11:45892247-45892269
Sequence GTCCTCTGGGAAGACGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 189}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081806225_1081806233 10 Left 1081806225 11:45892247-45892269 CCAGCACCGTCTTCCCAGAGGAC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1081806233 11:45892280-45892302 AGCCCAGACTCTGGTGTAGGTGG 0: 1
1: 0
2: 1
3: 23
4: 292
1081806225_1081806238 19 Left 1081806225 11:45892247-45892269 CCAGCACCGTCTTCCCAGAGGAC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1081806238 11:45892289-45892311 TCTGGTGTAGGTGGGGACACAGG 0: 1
1: 0
2: 3
3: 62
4: 753
1081806225_1081806232 7 Left 1081806225 11:45892247-45892269 CCAGCACCGTCTTCCCAGAGGAC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1081806232 11:45892277-45892299 CCTAGCCCAGACTCTGGTGTAGG 0: 1
1: 0
2: 2
3: 16
4: 173
1081806225_1081806230 1 Left 1081806225 11:45892247-45892269 CCAGCACCGTCTTCCCAGAGGAC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1081806230 11:45892271-45892293 TGACATCCTAGCCCAGACTCTGG 0: 1
1: 0
2: 1
3: 11
4: 127
1081806225_1081806236 12 Left 1081806225 11:45892247-45892269 CCAGCACCGTCTTCCCAGAGGAC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1081806236 11:45892282-45892304 CCCAGACTCTGGTGTAGGTGGGG 0: 1
1: 0
2: 0
3: 18
4: 295
1081806225_1081806234 11 Left 1081806225 11:45892247-45892269 CCAGCACCGTCTTCCCAGAGGAC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1081806234 11:45892281-45892303 GCCCAGACTCTGGTGTAGGTGGG 0: 1
1: 0
2: 0
3: 23
4: 385
1081806225_1081806239 30 Left 1081806225 11:45892247-45892269 CCAGCACCGTCTTCCCAGAGGAC 0: 1
1: 0
2: 2
3: 16
4: 189
Right 1081806239 11:45892300-45892322 TGGGGACACAGGAAGTTGATTGG 0: 1
1: 0
2: 0
3: 20
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081806225 Original CRISPR GTCCTCTGGGAAGACGGTGC TGG (reversed) Intronic
900501734 1:3009162-3009184 CTCCTGTGGGATGACGGAGCTGG + Intergenic
900604334 1:3517082-3517104 GGCCCCTGGGAAGGCGGGGCCGG - Intronic
902678526 1:18026734-18026756 GTACTTTGGGAGGACGGGGCGGG - Intergenic
903181767 1:21608484-21608506 GGCCTGGGGGAAGGCGGTGCAGG - Intronic
908183842 1:61632837-61632859 GTCCTCAGGTAAAACAGTGCAGG - Intergenic
909856275 1:80536481-80536503 GTGTTCTGGGAAGAGGGAGCGGG - Intergenic
912581392 1:110724188-110724210 ATCCTTTGGGAAGATGGTGCTGG - Intergenic
913150594 1:116038689-116038711 GTCTTCTGGTAAGACTGTGATGG + Intronic
915955055 1:160214136-160214158 GTACTCTGGAGAGACTGTGCTGG + Exonic
916911345 1:169350423-169350445 GTCTTCTGGGAAGGCAGTGCTGG - Intronic
918144938 1:181747307-181747329 GTCCTTTGAGAAGAGGGGGCTGG + Intronic
918569996 1:185978925-185978947 GTACTTTGGGAAGACGATGTGGG - Intronic
919624643 1:199899428-199899450 GTACTTTGGGAAGCCGATGCAGG + Intergenic
920676391 1:208041302-208041324 GTCCTCTGGGCAGCAGGGGCTGG - Intronic
920688305 1:208126782-208126804 GTGCTCTGGGAAGGCAGGGCAGG - Intronic
921525070 1:216207402-216207424 GTCCTCTGGGCGGAGGTTGCTGG + Exonic
922563347 1:226585299-226585321 GTCCTCTGAGGAGGCAGTGCTGG - Intronic
923500246 1:234558648-234558670 GGCCTCTAGGAAGCCGGTACAGG - Intergenic
924019085 1:239761738-239761760 GACCACTGGGAAGAAGCTGCAGG - Intronic
1063434943 10:6022025-6022047 TGCCTCTTGGAAGACAGTGCAGG + Intronic
1064581304 10:16795862-16795884 AGCCCCTGGGAAGAGGGTGCCGG - Intronic
1067082195 10:43218071-43218093 GTCGCCTGGGAAGCAGGTGCTGG - Intronic
1072491187 10:95907605-95907627 GTCCCCGGGGAGGACGCTGCGGG - Intronic
1073182329 10:101591930-101591952 GCCCTTTGGGAAGCCGATGCAGG - Intronic
1076312322 10:129517327-129517349 GTGCTCTGGGGAGCCTGTGCTGG - Intronic
1076752517 10:132550730-132550752 GACCTCATGGAAGACGGTGGAGG + Intronic
1079193577 11:18303604-18303626 GTACTTTGGGAAGCCGATGCAGG + Intronic
1080818958 11:35787104-35787126 GACCTCTGGGAAAGCGGTGTGGG + Intronic
1081565780 11:44260192-44260214 GTCCTCTGGGACAAGGGGGCTGG + Intergenic
1081806225 11:45892247-45892269 GTCCTCTGGGAAGACGGTGCTGG - Intronic
1083247403 11:61440066-61440088 CTCCTCTGGGAAGCCGAGGCAGG + Intronic
1084166920 11:67379439-67379461 GTCCTTTGGGAAGCCTGAGCTGG - Intronic
1084299078 11:68234040-68234062 GTGCTCTGGGAGGACGAAGCAGG - Intergenic
1084444883 11:69197755-69197777 GGCCTCAGGGAAGATGGAGCTGG + Intergenic
1084784992 11:71437126-71437148 GTCCTGTGGGATGGAGGTGCGGG - Intronic
1088008409 11:104969701-104969723 ATCCTCTGGGAAGAAGCTTCCGG + Intergenic
1089679599 11:120111914-120111936 GTCCTCTGGGAAGCAGGAGGTGG + Exonic
1090414141 11:126529145-126529167 GTCCTCTTGGAGGAAGGCGCGGG + Intronic
1090782292 11:130018229-130018251 GTCCTTTGGGAGGCCGGGGCTGG + Intergenic
1091309601 11:134563116-134563138 GTCCTCTGGTGAGAAGGGGCTGG - Intergenic
1096143840 12:49264726-49264748 GTCCACTGGGAGGAGGGAGCAGG - Intronic
1096147950 12:49292434-49292456 GGACTCTGGGCAGATGGTGCAGG - Intergenic
1097260234 12:57715760-57715782 TTCCTCTGTGACGAGGGTGCAGG + Exonic
1098454071 12:70652674-70652696 GACCTCTGGGAAGACCTTGGTGG + Intronic
1101307451 12:103543360-103543382 GCACTCTGGGAAGACGAGGCAGG + Intergenic
1101572553 12:105967185-105967207 TGCCTCTGGGATGAGGGTGCTGG - Intergenic
1102877392 12:116458821-116458843 GGCCTGTGGGCAGGCGGTGCCGG + Intergenic
1105003089 12:132703713-132703735 GACCTCTGGGCAGAGGGGGCTGG + Intronic
1106760064 13:32859269-32859291 GTGCTCTGGGAAGAAGCTGCAGG - Intergenic
1107818592 13:44266411-44266433 GGCCTCTGGGAAGACACAGCAGG - Intergenic
1107851528 13:44576940-44576962 GTCCTCGGGGAGGAAGGGGCCGG + Intronic
1112407391 13:99133443-99133465 GCCCTCTCAGAAGACAGTGCTGG + Intergenic
1113084529 13:106554638-106554660 GCACTTTGGGAGGACGGTGCGGG + Intronic
1114738152 14:25064232-25064254 GTCCTCTGGGAACAACGTGGTGG + Intergenic
1115762026 14:36584382-36584404 GTCCTCTCTGCAGACGGGGCCGG + Intergenic
1115855163 14:37622678-37622700 GTCCTCTGCGGAGACGGAGCTGG - Intronic
1118292784 14:64541184-64541206 CTCCTCTGGGAAGAAGGTCTTGG - Exonic
1118445955 14:65851390-65851412 GTCCTCTGGGAAGAGAGTGCAGG - Intergenic
1119920304 14:78440335-78440357 TTCCTCAGGGAAGAAGGTGATGG - Intronic
1122784069 14:104155851-104155873 GCCCTGTGGGAAGAGGGTGGAGG + Intronic
1122924107 14:104891944-104891966 GCCATCTGGGCAGAGGGTGCTGG + Intronic
1123034369 14:105465955-105465977 GTCCTGTGGGAAGAGGTGGCTGG + Intronic
1123462029 15:20481710-20481732 TGCCTCTGGGAAGAAGGGGCAGG + Intergenic
1123656027 15:22518678-22518700 TGCCTCTGGGAAGAAGGGGCAGG - Intergenic
1124272715 15:28297695-28297717 TGCCTCTGGGAAGAAGGGGCAGG + Intronic
1124309937 15:28613851-28613873 TGCCTCTGGGAAGAAGGGGCAGG - Intergenic
1126041390 15:44594497-44594519 GTGCTCTGGGAAGATGAGGCAGG + Intronic
1127597026 15:60495540-60495562 GTGCTCTGGGAAGCCCATGCTGG + Intronic
1128257113 15:66205085-66205107 GTCCTCTGGCAAGAGAGAGCAGG - Intronic
1129878213 15:78990776-78990798 GTCCTGTGGGCAGAAGGGGCCGG + Intronic
1129904918 15:79179743-79179765 GTAATCTGGGAACACTGTGCTGG + Intergenic
1130971770 15:88739396-88739418 GCCCTCTGGGAATACTGTCCTGG + Intergenic
1131632720 15:94196142-94196164 GCCCTCTGGGCACAGGGTGCAGG + Intergenic
1132465081 16:73647-73669 TTCCTCTGGATAGAGGGTGCAGG + Intronic
1132704476 16:1237175-1237197 CTCCTCTGGGAGGAGGGAGCTGG + Intergenic
1133021171 16:2967589-2967611 GTCCGCTGCGCCGACGGTGCGGG + Exonic
1134403417 16:13933460-13933482 GTACTTTGGGAAGCCAGTGCAGG + Intronic
1134823625 16:17266823-17266845 GTCCTTTTGGAAGCAGGTGCAGG - Intronic
1135346875 16:21696270-21696292 GTCCTCTGGGAATTCAGTGGAGG + Intronic
1135435871 16:22426237-22426259 GTCCTCAGGGAAGCTGGGGCTGG - Intronic
1135946980 16:26873786-26873808 CTCCTCTTGGGAGACTGTGCTGG - Intergenic
1136400521 16:30015168-30015190 GACCTCTGGGGAGACAGGGCAGG + Intronic
1137468048 16:48729139-48729161 GTCCTCAGGGAAGACTATCCGGG - Intergenic
1138498355 16:57422807-57422829 GTCCTCTGGGAGGACAGCGAAGG + Intergenic
1138635010 16:58331361-58331383 GTGATCTGGGATGACGGTGAGGG + Intronic
1140808884 16:78558165-78558187 GACCTCCGGGAAGGCGGTGGTGG - Intronic
1140964086 16:79947284-79947306 GCCTTCTGGGAAGATGGTGAGGG + Intergenic
1142045081 16:87920067-87920089 GTCCTCAGGGAAGCTGGGGCTGG - Intronic
1142216870 16:88834333-88834355 GTGGTCTGGGAAGAGGCTGCAGG + Intronic
1142216884 16:88834368-88834390 GTGGTCTGGGAAGAGGCTGCAGG + Intronic
1142216896 16:88834401-88834423 GTGGTCTGGGAAGAGGCTGCAGG + Intronic
1142216920 16:88834470-88834492 GTGGTCTGGGAAGAGGCTGCAGG + Intronic
1142216941 16:88834542-88834564 GTGGTCTGGGAAGAGGCTGCAGG + Intronic
1142216965 16:88834611-88834633 GTGGTCTGGGAAGAGGCTGCAGG + Intronic
1144658082 17:17050814-17050836 GTCCTGTGGGGAGCCGGTGAGGG + Intronic
1144661113 17:17071631-17071653 GGCCTCTAGGAAGAGGCTGCTGG - Intronic
1147987017 17:44312580-44312602 GTTCTCTGTGAAAACGCTGCTGG + Exonic
1148127075 17:45242422-45242444 GAGCTCTGTGAAGACAGTGCCGG - Exonic
1148731334 17:49838613-49838635 GTCCTCTGGGAAGTCTGTGGTGG + Exonic
1150223584 17:63510670-63510692 ATCCTCTGGGAAGAGGGTGAGGG - Intronic
1152407316 17:80105053-80105075 GTCCTTGGGGAAGAAGGTGGGGG - Intergenic
1158851466 18:61499228-61499250 ATCCTCTCGGGAGAAGGTGCTGG + Exonic
1159007191 18:63023767-63023789 TTCTTCAGGGAAGATGGTGCAGG - Intergenic
1159946175 18:74446348-74446370 GCCCTCTGGGAGGACGAAGCTGG + Intronic
1160442836 18:78905429-78905451 GTCCTTTGGGAGGCCGGGGCAGG + Intergenic
1162554532 19:11378533-11378555 GTCCTCCGTGAAGGGGGTGCAGG + Exonic
1164699899 19:30277898-30277920 GCCCTCTGGGAGGAGGGTGGTGG + Intronic
1165135623 19:33666558-33666580 GGCATCAGGGAAGAGGGTGCCGG + Intronic
1165159047 19:33805259-33805281 AGTCTCTGGGAACACGGTGCAGG - Intronic
1166825902 19:45608819-45608841 GCACTCTGGGAAGCCGATGCAGG - Intronic
1166869860 19:45864530-45864552 GTCCTCGGGGATGGCGGAGCGGG + Intronic
1167052706 19:47089530-47089552 GTCCTTTGGGAGGAAGGTGGAGG - Intronic
1167207067 19:48109893-48109915 GCCCTTTGGGAAGACGAGGCGGG - Intronic
925601479 2:5612447-5612469 GACGTCTGGGATGACGGTGTTGG - Intergenic
925836559 2:7952224-7952246 CTCCTCTGAGAAGCCTGTGCAGG - Intergenic
925859092 2:8157721-8157743 GTCCTCTGGGAACACAGCCCTGG + Intergenic
932431098 2:71674042-71674064 GTCCTGTGGGAAGACTGGGAAGG - Intronic
934857860 2:97739967-97739989 GACCCCTGGGAAGATGGGGCTGG + Intergenic
938387836 2:130880336-130880358 ATCCTCTGGGAAGGCAGAGCTGG - Intronic
942088379 2:172463951-172463973 GTCCTCTGTCAAGAAGGTTCAGG + Intronic
946195004 2:218027638-218027660 CTCTTCTGGGAAGTCAGTGCGGG - Intergenic
947033352 2:225823324-225823346 ATCCTCTGGGAAGAAGGCTCAGG - Intergenic
947213478 2:227728636-227728658 GGCCTCTGGGAAGATGCTGCAGG + Intergenic
948805129 2:240450657-240450679 TTCCTCTGGGGAGGAGGTGCTGG + Exonic
1168841765 20:914343-914365 GGCCTCTGGGGAGATGGCGCTGG + Intronic
1170546306 20:17437994-17438016 GTCCTCTGGGAGCACGGTGTGGG - Intronic
1171348373 20:24483961-24483983 GTCTTCTCGGCAGAGGGTGCAGG + Intronic
1174102808 20:48140015-48140037 GTACTCTGGGAAGACCCAGCAGG - Intergenic
1175503168 20:59464506-59464528 GGCCTCTGTGAAGAAGCTGCAGG - Intergenic
1176114646 20:63426296-63426318 GGCCTCTGTGGAGACGGTGGAGG + Intronic
1179266202 21:39805715-39805737 GTCCCCTGGGAGGACTGTGCTGG + Intergenic
1179466948 21:41582039-41582061 GGCCTCTGGGAGGACCGCGCAGG + Intergenic
1179798320 21:43798552-43798574 GTCCTCTGGGGAGACGGGCCAGG - Intronic
1181280447 22:21716153-21716175 GCACTCTGGGAAGCCGGGGCAGG - Intronic
1184097345 22:42323693-42323715 TGCCTCTGGGAAGAAGGTGTGGG - Intronic
1184947487 22:47813836-47813858 GTGCGCAGGGAAGAGGGTGCCGG + Intergenic
1185063199 22:48617784-48617806 GTGTTCTGAGAAGACGGAGCAGG + Intronic
950303329 3:11900126-11900148 GTCCTCTGCAAAGATGATGCTGG - Intergenic
950506727 3:13399729-13399751 GTCCTCTGCGAAGATGATGCTGG + Exonic
951427899 3:22569874-22569896 GTCCTCAGGCAACAGGGTGCTGG + Intergenic
954240157 3:49287398-49287420 GTACTTTGGGAAGCCGGGGCGGG - Intronic
954361864 3:50126420-50126442 GTCCTATGGGAGGACAGTCCAGG + Intergenic
957913766 3:86659066-86659088 GTCCCCTGGGAGGTCAGTGCAGG + Intergenic
961037965 3:123656075-123656097 GGCCTCTGGGATGACAGTCCAGG - Intronic
961638715 3:128351086-128351108 GTCCTCCGAGAAGACTTTGCTGG + Intronic
961819390 3:129567489-129567511 GACCTTGGGGAAGAAGGTGCGGG + Exonic
969481160 4:7447726-7447748 CTGCTCTTGGAAGACGGAGCCGG + Intronic
971280288 4:25237610-25237632 GTGCTCTGGGAAGCCGAGGCGGG - Intronic
985656938 5:1137222-1137244 GTGCTCTGGGAAGAGGGCACAGG - Intergenic
997198410 5:131994882-131994904 GTCCTCTTGGTAGTCGGTGAGGG - Intronic
997528534 5:134568552-134568574 CTCCTCTGGGAAGAGGAAGCAGG + Intronic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1003248239 6:4402112-4402134 GCGCTCTGGGAAGAGGCTGCTGG - Intergenic
1003250648 6:4426739-4426761 GTGCTCTGAGAAGGCAGTGCAGG - Intergenic
1003406038 6:5828141-5828163 GTCCTCTGGGGTAAGGGTGCTGG + Intergenic
1010963050 6:82168877-82168899 GTACTCTGGGAGGGCGATGCTGG - Intergenic
1011182238 6:84633986-84634008 GTCCACTGGGACCACAGTGCAGG - Intergenic
1013067323 6:106696367-106696389 GCCCTTTGGGAAGCCGATGCGGG + Intergenic
1015536316 6:134270809-134270831 GTCCTCTGAAGAGACGGAGCTGG - Intronic
1016522316 6:144960167-144960189 GTCCTAGGGAAAGAAGGTGCTGG - Intergenic
1017135197 6:151141891-151141913 GCCCTATGGGAACACGGGGCAGG + Intergenic
1017918783 6:158853919-158853941 GTCTTCAGGGAAGACCTTGCCGG - Intergenic
1019135998 6:169908014-169908036 GTGCTCAGGGAACACAGTGCAGG + Intergenic
1019157414 6:170048629-170048651 GTCCTCGGGGAGCACGGTGGGGG + Intergenic
1019307662 7:343534-343556 GTCCTCTGGTCTCACGGTGCTGG - Intergenic
1019365824 7:632330-632352 GGTCTCTGCGAAGCCGGTGCCGG - Intronic
1019546635 7:1580658-1580680 GTCCTCTGGGGAGACGGGCCAGG + Intergenic
1019592703 7:1843720-1843742 GTGCTCCAGGAAGACGGAGCTGG - Intronic
1020140169 7:5607511-5607533 GTGCGCTGGGAAGGCGGTGATGG + Intergenic
1029145816 7:98445131-98445153 GTGCTCTGGGAGGCCGGGGCAGG + Intergenic
1029544483 7:101203013-101203035 GTCCCCTGGGAAGAGGATGGTGG + Intergenic
1030291732 7:107879557-107879579 CTCTTCTGGGCAGAAGGTGCTGG + Intergenic
1033651884 7:143350203-143350225 GTCCCCTGGGAAGAAGGAGGAGG + Intronic
1035157789 7:156928369-156928391 TTCCTCTGGGAACACTGGGCTGG + Intergenic
1035565025 8:635589-635611 GTCCTCTGGCAGGTCGGGGCCGG - Intronic
1036646253 8:10612706-10612728 GCCCTCGGGGAGGCCGGTGCTGG + Exonic
1036677854 8:10850163-10850185 GTACTCTGGGAAGCCGAGGCGGG - Intergenic
1037892434 8:22630369-22630391 GGCCTCTGGGTGGACTGTGCGGG - Intronic
1042591895 8:70404119-70404141 GTCCTCTGAGAAGGCGGCCCGGG + Intergenic
1045394204 8:101744275-101744297 GTCTGCTGGGAAGACAGAGCTGG - Intronic
1045688413 8:104735526-104735548 GTGCTCAGGGAAGACAGTGCAGG + Intronic
1048260991 8:132944901-132944923 TCCCTGTGGGAAGAGGGTGCAGG + Intronic
1048263830 8:132967860-132967882 TGCCTCTGGGTAGAGGGTGCAGG - Exonic
1049690507 8:143956917-143956939 TTCCTTTGGGAAGCCTGTGCCGG - Intronic
1049702902 8:144023136-144023158 GTCCTGAGGGAAGAGGGTCCTGG - Intronic
1049777457 8:144413282-144413304 GTCCTCCTGGAAGACCGGGCTGG - Exonic
1049856680 8:144866464-144866486 GTCCTCAGGGGTGAGGGTGCAGG + Intergenic
1051192976 9:14534286-14534308 GAGCTCTTGGAAGGCGGTGCTGG - Intergenic
1053299381 9:36937807-36937829 GTCCTCTGAGTTGACGGTGTAGG - Intronic
1056273629 9:84971446-84971468 GTACTCTGGGAAGACTGAGGAGG + Intronic
1057726533 9:97572347-97572369 GTGCTCTGGGAAGATGGTTCTGG + Intronic
1057875153 9:98747966-98747988 GGCATCTGGGAAGAGGGAGCAGG - Intronic
1058808099 9:108612288-108612310 AGCCTCTGGGAAGATGATGCTGG - Intergenic
1059093665 9:111389315-111389337 GTCCACTGGGAAGATGGTTAAGG - Intronic
1059165507 9:112073060-112073082 GTCCTCAGGGAAGACTGTGCAGG - Intronic
1060404806 9:123367939-123367961 GTCTTCAGGGAAGACGGAGGTGG + Intronic
1060963557 9:127698879-127698901 GTCTTGTGGGAAGCCGCTGCTGG - Intronic
1061010350 9:127950917-127950939 GGCCTGTGGGAAGTGGGTGCTGG + Intronic
1061613464 9:131763700-131763722 GTGCTCTGGCCAGACGGTGTGGG - Intergenic
1061714983 9:132513442-132513464 GTCCTCAGGGAAGACGGGGAGGG - Intronic
1187683426 X:21792160-21792182 GTCCTCTGGTTAGAGAGTGCAGG - Intergenic
1192260519 X:69503895-69503917 GTCCTCGGGCAGGACGGTGAGGG + Intergenic
1194499860 X:94668609-94668631 TTCCTCAGGGAAGAGGGTTCAGG - Intergenic
1194534949 X:95094782-95094804 GGCCGCTGGGAAGTCAGTGCTGG - Intergenic
1196438516 X:115695934-115695956 GTCCTTAGGGAACAAGGTGCTGG + Intergenic
1197950246 X:131887349-131887371 GTACTTTGGGAAGCCGGGGCAGG + Intergenic
1199034201 X:143032098-143032120 GTCTTCTGGGGAGAGGGTGGAGG + Intronic
1201077978 Y:10200772-10200794 GTCCACTGGGGAGAGGGTGGGGG + Intergenic