ID: 1081807701

View in Genome Browser
Species Human (GRCh38)
Location 11:45899476-45899498
Sequence GGGATCTGTCCAAGGTGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 230
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 202}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081807693_1081807701 10 Left 1081807693 11:45899443-45899465 CCACTCAACTGATGAGGGGGCCT 0: 1
1: 0
2: 0
3: 4
4: 78
Right 1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG 0: 1
1: 0
2: 2
3: 25
4: 202
1081807691_1081807701 12 Left 1081807691 11:45899441-45899463 CCCCACTCAACTGATGAGGGGGC 0: 1
1: 0
2: 1
3: 11
4: 110
Right 1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG 0: 1
1: 0
2: 2
3: 25
4: 202
1081807698_1081807701 -10 Left 1081807698 11:45899463-45899485 CCTGAAGGATCAGGGGATCTGTC 0: 1
1: 0
2: 1
3: 11
4: 112
Right 1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG 0: 1
1: 0
2: 2
3: 25
4: 202
1081807692_1081807701 11 Left 1081807692 11:45899442-45899464 CCCACTCAACTGATGAGGGGGCC 0: 1
1: 0
2: 1
3: 5
4: 65
Right 1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG 0: 1
1: 0
2: 2
3: 25
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081807701 Original CRISPR GGGATCTGTCCAAGGTGCCA GGG Intronic
900436451 1:2633392-2633414 GGGATCTTGCCAAGGTGCAAGGG + Intergenic
900947870 1:5841324-5841346 GGCATCAGACCAAGGTGCCCAGG - Intergenic
901878294 1:12179508-12179530 GGTATCTGCCCAAGGACCCAGGG - Intronic
903686195 1:25134047-25134069 GGGATCTTGCCAAGTTGCCCAGG + Intergenic
903739531 1:25550677-25550699 GGGACCTGTGCAAGGTAACATGG - Intronic
903891543 1:26573394-26573416 GGGGTCAGCCCAAGGTGGCATGG + Intronic
904405923 1:30287856-30287878 GTGATTTGTCCAAGGTCACAGGG + Intergenic
904875296 1:33650182-33650204 AGGCACTGTGCAAGGTGCCAAGG + Intronic
905359414 1:37408859-37408881 TGGATTTGTCTAAGGTGCCATGG - Intergenic
905823156 1:41009753-41009775 GGGACCTGGCCAATATGCCAGGG - Intronic
906216716 1:44045368-44045390 GTGTGCTGTCCAAAGTGCCAGGG - Intergenic
906747015 1:48229133-48229155 GGGATCCATCCAAGGTCACACGG + Exonic
906925028 1:50106300-50106322 GGGATGTGTGCATGGTGGCAAGG + Exonic
908191809 1:61711456-61711478 GGGATCTCTCCATGTTGCCCAGG - Intronic
908767803 1:67570016-67570038 GGGAGCAGTCAAAGATGCCATGG + Intergenic
909484597 1:76158986-76159008 GGGTTCTCTCCAATGTGCCAGGG + Intronic
911226114 1:95307389-95307411 GGGATCTGTCCTATGGGTCACGG - Intergenic
911941647 1:104055066-104055088 GGGATATGTGCATGGTGCTAAGG + Intergenic
912862595 1:113227292-113227314 AGGTACTGTCCTAGGTGCCAGGG + Intergenic
914007752 1:143747734-143747756 GGGAGCTGACCAAATTGCCAAGG + Intergenic
917497833 1:175557495-175557517 GTGAACTGTCCAAGGTGCTGGGG - Intronic
919654020 1:200180281-200180303 GGGAGATGTCCATGGTGGCAGGG - Intergenic
919777672 1:201204944-201204966 GTGACCTGTCCAAGGTAACATGG + Intronic
919818179 1:201455233-201455255 GGGAGTTGTCCAAGGTCACAGGG + Intergenic
921971387 1:221153097-221153119 GATATCTGTCCAGGGTGCCGAGG + Intergenic
923689834 1:236181358-236181380 GGGCACTGTGCAAAGTGCCAGGG + Intronic
1063517842 10:6713882-6713904 GGGAGCTGTCCGAGGTGCTCTGG - Intergenic
1063551076 10:7033792-7033814 GGGATCTGTCCATTGAGTCATGG + Intergenic
1064250843 10:13705386-13705408 AGGATTTGTCCAAGGTGCCTGGG + Intronic
1064361155 10:14666065-14666087 AGGCACTGTCCAAGGTGCTAGGG + Intronic
1065148881 10:22801284-22801306 GGGATCTTTCCATGTTGCCCAGG + Intergenic
1067343862 10:45424271-45424293 GGGTGCTGTCCAGGGTGGCATGG - Intronic
1072171179 10:92863584-92863606 GGGATCTCTCCATGTTGCCCAGG - Intronic
1073096444 10:100983199-100983221 GGGTTCTGTGCTTGGTGCCAGGG + Intronic
1075525916 10:123186684-123186706 GGGACATGTCCAAGGGCCCAAGG + Intergenic
1075879647 10:125839823-125839845 GTCTTCTGTCCATGGTGCCATGG - Intronic
1077120424 11:904981-905003 GGGCTCTGTCCCAGTGGCCAAGG - Intronic
1078101812 11:8334494-8334516 GGGAGCTGGCCCAGGAGCCAAGG - Intergenic
1078513894 11:12007413-12007435 GGGAGCTGTCCCTGGTGCCTGGG - Intronic
1078631631 11:13009300-13009322 TGGCTCTGCCCAAGGTGCCCGGG - Intergenic
1078869670 11:15331731-15331753 GGGAGATGTACAAGGTGCCATGG + Intergenic
1079391424 11:20025124-20025146 GTGACCTGCCCAAGGTGCCAGGG - Intronic
1079489733 11:20974134-20974156 AGGAACTGTCCGAGGTGCTAGGG - Intronic
1081130826 11:39377945-39377967 GTGATTTGTCCAAGGTTACATGG - Intergenic
1081807701 11:45899476-45899498 GGGATCTGTCCAAGGTGCCAGGG + Intronic
1083336515 11:61924819-61924841 GGAGTCTGACCAAGGTGCCTGGG + Intergenic
1083746599 11:64740519-64740541 GGAGTCTGTACAAAGTGCCATGG + Intronic
1085082988 11:73648994-73649016 GGGACCTGTCAGAGGAGCCACGG - Exonic
1087122589 11:94590340-94590362 GGGATGTGTCCCAGGAGTCAAGG - Intronic
1088183992 11:107143130-107143152 GGGCTCTGCCTAAGGTTCCAGGG + Intergenic
1089270609 11:117299376-117299398 GTGATCTGCTCAAGGTGACAGGG - Intronic
1090856041 11:130609947-130609969 GGACTCTGTCCAGGGAGCCATGG + Intergenic
1091974481 12:4813515-4813537 GGGCTCAGTCCAAGAGGCCAAGG - Intronic
1093888432 12:24490232-24490254 TGAATCTGTTCTAGGTGCCATGG - Intergenic
1094840093 12:34339238-34339260 GGGAGCTGCCCAAAGTGGCAGGG + Intergenic
1096675632 12:53224296-53224318 AGGATGTCCCCAAGGTGCCAGGG + Intronic
1097182479 12:57179201-57179223 GGGGTATGTCCACGGAGCCAAGG + Intronic
1098101335 12:67020594-67020616 GGGATCTCTCTAAGTTGCCTAGG + Intergenic
1100341365 12:93682935-93682957 GTGTTCTCTCCACGGTGCCAAGG - Intronic
1102535885 12:113580679-113580701 GGGCACTGTCCTAGGTGCTAGGG + Intergenic
1102544764 12:113646456-113646478 GTGACCTGTGCAAGGTGACAAGG - Intergenic
1104386101 12:128352945-128352967 GGGAACTGTCCGAGGTGGGAGGG + Intronic
1104417855 12:128610043-128610065 GGGATCTCTCCATGGTGCTGAGG - Intronic
1104936202 12:132365691-132365713 GGTTTCTGGCCCAGGTGCCACGG + Intergenic
1104936226 12:132365809-132365831 GGTTTCTGGCCCAGGTGCCACGG + Intergenic
1104936251 12:132365927-132365949 GGTTTCTGGCCCAGGTGCCACGG + Intergenic
1104962163 12:132493505-132493527 GGGGTCTGCCCCAGGGGCCAGGG - Intronic
1105898043 13:24734374-24734396 GGGCACTGTGCTAGGTGCCAGGG - Intergenic
1108411394 13:50151175-50151197 GGGGTCTCTCCATGTTGCCAAGG + Intronic
1111648226 13:91058394-91058416 GGGGTCTGGGTAAGGTGCCATGG - Intergenic
1117042666 14:51780935-51780957 GGGAGCTGTCCAAGGTGTCACGG + Intergenic
1120291681 14:82581406-82581428 GTTATCTGTCCAAGGTGACCAGG - Intergenic
1122193417 14:100066372-100066394 GGGGTTTGTCCAAGGTCACATGG + Intronic
1122636845 14:103134013-103134035 AGGATGTGTCCAAGGTGACACGG + Intronic
1123990102 15:25677002-25677024 AGGTTCTGTGCAAGGTGCCAGGG + Intergenic
1124637569 15:31374722-31374744 GTGATCTGCCCAGGGTGTCACGG + Exonic
1124956769 15:34365334-34365356 AGGATGTGACCAAGGGGCCAAGG + Intronic
1131286758 15:91065821-91065843 AGGCTCTGTCCAGGGTGACAGGG - Intergenic
1132113400 15:99118525-99118547 GGGATTTGTCCATTGTCCCAAGG + Intronic
1132145039 15:99424578-99424600 GGGATATTCCCAAGGTGGCAGGG + Intergenic
1133690433 16:8209306-8209328 AGGATCTGTCCAAGGTCACATGG - Intergenic
1136616615 16:31402197-31402219 GGGCTTTGTCCAAGCTGTCATGG + Exonic
1137481854 16:48858515-48858537 GAACTCTGTCCAAGCTGCCATGG - Intergenic
1138345710 16:56318944-56318966 GTGTTCTGTCCAAGGTCACATGG + Intronic
1139618536 16:68117099-68117121 AGGATCTGAACAAGGGGCCAAGG + Intronic
1140432742 16:74918802-74918824 ATGATCTGTCCAAGGTCACAGGG + Intronic
1142824742 17:2502076-2502098 GTGATTTGTCCAAGGTCGCATGG + Intronic
1143387133 17:6537749-6537771 GGGAACTCTGCTAGGTGCCAGGG - Intronic
1144537409 17:16104380-16104402 GGGAGCTGTCTGAGGTACCACGG + Intronic
1145275934 17:21430479-21430501 GGGAACTGTCCTAGGTTCCAGGG - Intergenic
1145313780 17:21716392-21716414 GGGAACTGTCCTAGGTTCCAGGG - Intergenic
1145712222 17:26988366-26988388 GGGAACTTTCCTAGGTTCCAGGG - Intergenic
1146290155 17:31601005-31601027 AGGATCTGTCCAAGGCTGCAGGG - Intergenic
1146627950 17:34448207-34448229 GGGCACTGTGCTAGGTGCCAGGG + Intergenic
1148961927 17:51400697-51400719 AGGAACTGTCCTAGGTGCCAGGG - Intergenic
1149567948 17:57652872-57652894 GGGATATGTCCAGGGTGCCCGGG + Intronic
1149769449 17:59308842-59308864 GGGATCTCTCTATGTTGCCAAGG - Intergenic
1151817528 17:76478684-76478706 GGCATCTGCCTACGGTGCCAAGG - Intronic
1153242952 18:3047270-3047292 GGGGTCTTTCCATGTTGCCAGGG - Intergenic
1153697126 18:7655246-7655268 GGGATCTCACCAAGTTGCCCAGG + Intronic
1154346033 18:13544269-13544291 GGGACTTGTCTAGGGTGCCATGG + Intronic
1154472837 18:14721744-14721766 AGGAGCTGTCCAAGGTGCTTAGG + Intergenic
1156474830 18:37398796-37398818 GGGATTTGTCCAAGGTGGCTGGG - Intronic
1157612474 18:48966615-48966637 GTGATGTGTCCAAGGTCACAAGG - Intergenic
1163245525 19:16091581-16091603 GGGATCTCTCCATGTTGCCCAGG - Intronic
1164035305 19:21449147-21449169 GGGAACTGCCCCATGTGCCAAGG - Intronic
1165717195 19:38053998-38054020 GGGACCTGTCCAAGGTCACACGG + Intronic
1167089543 19:47334087-47334109 AGGTTCTGTCCCAGATGCCAGGG + Intronic
1167555497 19:50192653-50192675 AGGAACTGTCCTAGGTGCTAGGG + Intronic
1168017431 19:53584660-53584682 GGGATCTTGCCATGTTGCCAAGG - Intergenic
927048697 2:19305472-19305494 TGGCTCTGTTCAAAGTGCCAAGG + Intergenic
928254069 2:29706855-29706877 GGGACTTGGCCAAGGTGGCATGG + Intronic
928440999 2:31291934-31291956 GGGATCTCTCCACGTTGCCCAGG + Intergenic
929214029 2:39391615-39391637 AGGCACTGTTCAAGGTGCCAAGG - Intronic
931127416 2:59293289-59293311 AGGATCTGTCACAGCTGCCACGG - Intergenic
931344308 2:61432145-61432167 GGGTTCTGTCTAAGTTGCCCAGG - Intronic
931704763 2:64938118-64938140 GGGCTCTGACCAGAGTGCCAGGG + Intergenic
933183953 2:79258325-79258347 GGGAACTGCCCAAGGTCGCATGG - Intronic
936287815 2:111194602-111194624 GGGCACTGACCGAGGTGCCAGGG + Intergenic
937749110 2:125453249-125453271 GAGATCTGTACAAGGTACCAGGG - Intergenic
941653398 2:168117795-168117817 GGGATCACTCCAGGGTCCCATGG - Intronic
943786713 2:191885623-191885645 GTTTTCTCTCCAAGGTGCCAGGG + Intergenic
946293513 2:218764672-218764694 GGGATCTGGCCATGTTGCCCAGG + Intergenic
948123192 2:235545965-235545987 AGGGTCTGGCCAAGGTGCCTAGG - Intronic
1169777949 20:9276590-9276612 GGGATTTGTCCAAGGTCACATGG + Intronic
1170486422 20:16821090-16821112 GGGATTTGTTCAAGGTCACATGG + Intergenic
1172239217 20:33401227-33401249 GTGACCTGTCCAAGGTCACACGG + Intronic
1174531954 20:51221311-51221333 GGGCTCTGTCCCAGGTGCTAGGG + Intergenic
1174557397 20:51405696-51405718 GGGCTCTGTCCTAGGTGCTGGGG - Intronic
1178915338 21:36702722-36702744 AGGATCTGTCTGAGCTGCCAGGG + Intronic
1181468256 22:23122368-23122390 GAGCTCTGTCCAGGATGCCAGGG + Intronic
1181773437 22:25143131-25143153 GGGCACCGGCCAAGGTGCCAAGG + Intronic
1182028872 22:27141844-27141866 GAGACCTGTCCAAGGTGTCCTGG + Intergenic
1182300192 22:29332867-29332889 GTGAGCTGTCCAAGGAGCCCAGG + Intronic
1182442974 22:30374858-30374880 GTGAGCTGTCCAAGGTCACACGG - Exonic
1184041704 22:41947824-41947846 GGGATCTGGCCATGTTGCCCAGG + Intergenic
1184646621 22:45898803-45898825 GTGACTTGTCCAAGGTACCACGG + Intergenic
1184687823 22:46104440-46104462 GGGCTCTGTCCAGGCCGCCAAGG - Intronic
949926783 3:9048074-9048096 GTGATTTGTCCAAGGTCCCACGG + Intronic
950191114 3:10976801-10976823 GGGATTTGTTCAAGGTCACATGG - Intergenic
951888969 3:27551553-27551575 GAGATCTGGCCACTGTGCCAAGG - Intergenic
959139317 3:102466121-102466143 GGGCTCTGTCCTTGGTGGCAAGG + Intronic
959575562 3:107929213-107929235 GGGGTCTAATCAAGGTGCCATGG - Intergenic
960639525 3:119812672-119812694 GGCATGTGTCCTAGCTGCCAGGG + Exonic
960986860 3:123286482-123286504 AAGATCTGTCCAAGGTGCTGAGG + Intronic
961132400 3:124481396-124481418 GGGATCTGGCCATGTTGCCCCGG + Intronic
962426898 3:135278096-135278118 GGGAATTTTCCAAGGTGGCAGGG + Intergenic
965660884 3:171040632-171040654 GGGATCTTTCCAGGTTGCCAAGG + Intergenic
968637533 4:1688957-1688979 GGGATCTTGCCATGTTGCCAGGG + Intergenic
969065673 4:4478619-4478641 GGGAGTTGGCCAAGGTGCCTGGG + Intronic
969530853 4:7729425-7729447 GGGATCCTTCCAGGGTCCCAGGG - Intronic
969700854 4:8766778-8766800 GGGCTCTGTCCTGGGTGCCAAGG - Intergenic
971612828 4:28747196-28747218 GTGCTATGTCCAAGATGCCAGGG - Intergenic
974079307 4:57195857-57195879 GGGATCTGTCCACCATGCCGCGG + Intergenic
975391035 4:73817537-73817559 GGGAACTGTCCAAGGTGACAGGG + Intergenic
975652003 4:76602809-76602831 GTGATCTGTCTAAGGTTGCACGG - Intronic
978120760 4:105076508-105076530 GGGATTTGTCCAAAGTTACAAGG + Intergenic
983151653 4:164290199-164290221 GGGGACTATCCAAGGTGCCAAGG - Intronic
984544183 4:181079501-181079523 GTGATCTGTCCAAGATTACAGGG + Intergenic
986292012 5:6407738-6407760 GAGCTCTGTCCAGGGTGCCTAGG - Intergenic
987147855 5:15010229-15010251 GAGACCTGCCCCAGGTGCCATGG + Intergenic
987328510 5:16834206-16834228 GGTTTCTGTCCAAGGTGCTGTGG - Intronic
988789084 5:34590822-34590844 GGGATCTCTCCATGTTGCCCAGG + Intergenic
993686401 5:90943361-90943383 GTGATCTGTCCAAGGTCATAAGG - Intronic
994680249 5:102877834-102877856 GGGATCTCTCCATGTTGCCCAGG - Intronic
996111514 5:119571502-119571524 GTTATCTGTCCAAAGAGCCAAGG + Intronic
997580194 5:135012201-135012223 GGGCTCTGTGCAAGGTGCCCTGG - Intergenic
999230991 5:150061637-150061659 GGCCTCTGTCCAAGGGCCCATGG + Intronic
1000556279 5:162730048-162730070 GGGATTTTGCCAAGTTGCCAAGG + Intergenic
1001217880 5:169872802-169872824 GTGATCTGCCCAAGATCCCAGGG - Intronic
1002097070 5:176837681-176837703 GGGCCCTTTCCAAGCTGCCATGG + Intronic
1003363017 6:5446567-5446589 CTGCTCTGTCCAAGGTGCTATGG + Intronic
1005761964 6:28975757-28975779 GGGGTCTCACCAAGTTGCCAAGG + Intergenic
1007072591 6:39048383-39048405 GGGACTTGTCCAAGGTCACACGG - Intergenic
1007394477 6:41569805-41569827 GGGATTTGGCCCAGTTGCCACGG - Intronic
1007557240 6:42776537-42776559 GGGATCTGACCATGTTGCCCAGG + Intronic
1007971725 6:46058573-46058595 GGAATATGTGCAAAGTGCCATGG + Intronic
1008589891 6:52983550-52983572 GTGACCTGTCCAAGGTAACATGG - Intronic
1008641422 6:53466409-53466431 GGGCATTGTTCAAGGTGCCATGG + Intergenic
1010366805 6:75060562-75060584 GGCATCTGTGCAGGGTGACAGGG - Intergenic
1012899844 6:104992699-104992721 GGGATCTCTCTATGGTGCCCAGG + Intronic
1013093260 6:106920559-106920581 GGGATCTCTCCATGTTGCCCAGG + Intergenic
1013270090 6:108537383-108537405 GGGAAGTGTCCAGGGTGCCCTGG + Intergenic
1013837176 6:114346245-114346267 GGGATCTCTCCATGCTGCCCAGG - Intergenic
1015421093 6:133009427-133009449 GGGATTTTTCCATGGTGCCCAGG + Intergenic
1017146933 6:151242700-151242722 GGGACGGGTCCATGGTGCCACGG - Intronic
1017214281 6:151892132-151892154 GTGATCTGCCCAAGGTTCCTAGG - Intronic
1017391237 6:153941773-153941795 GGAATGTGTCCATGATGCCAGGG - Intergenic
1018247512 6:161836860-161836882 GGGAGCTGTGTGAGGTGCCAAGG + Intronic
1018949659 6:168370876-168370898 GGGATCTTTCCAAGGCGTCTTGG + Intergenic
1021759052 7:23885567-23885589 GGGATCTTTCCATGTTGCCCAGG + Intergenic
1022496350 7:30855423-30855445 GGGATCTGGCCAGGGTGGCCAGG + Intronic
1023298829 7:38746160-38746182 AGGATCTGTCAAAGGTGAGAAGG + Intronic
1026438297 7:70419229-70419251 GGGAACAGGTCAAGGTGCCAGGG - Intronic
1026545572 7:71318962-71318984 GGGATCTGTCCAAGGTCATTGGG + Intronic
1026964753 7:74432131-74432153 GGGGTCTCTCTATGGTGCCAAGG + Intergenic
1026986687 7:74559354-74559376 GGGATTTGCCCAAGGTCCCGGGG + Intronic
1030084508 7:105805225-105805247 GAGCTCTGGCTAAGGTGCCAAGG + Intronic
1030924667 7:115437419-115437441 GTGAGTTGCCCAAGGTGCCATGG - Intergenic
1030979396 7:116168180-116168202 GTGATTTGTCTAAGGTTCCATGG - Intergenic
1032481499 7:132250812-132250834 GGGATTTGTCCAAGGCTACATGG + Intronic
1032516932 7:132513513-132513535 GGACTCTGTCCAAGGGGCCAGGG - Intronic
1033475554 7:141688741-141688763 GGGAGCTTTAAAAGGTGCCAGGG + Intronic
1035282758 7:157787803-157787825 GGGCCCCGTCCAAGCTGCCAAGG + Intronic
1039305429 8:36256854-36256876 GGGATTTGTTCAAGGTCCAAAGG - Intergenic
1039483832 8:37896394-37896416 TGGGACTTTCCAAGGTGCCAAGG - Intronic
1043724797 8:83597159-83597181 AGCATCTGTCCAAGTTGCAAAGG - Intergenic
1045218598 8:100174996-100175018 GGGATCTTGCCATGTTGCCAGGG + Intronic
1050024647 9:1321170-1321192 GTCATCTGTCCAAGCTGCCCTGG - Intergenic
1050490968 9:6187468-6187490 GGGAGCTGTCCAGGGTGCAGAGG + Intergenic
1051184086 9:14440250-14440272 GTGCTCTGTCCTAGGTGCTAAGG - Intergenic
1052320006 9:27157829-27157851 AGGAACTGTGGAAGGTGCCATGG + Exonic
1055764542 9:79648259-79648281 GGGAACTGAGCTAGGTGCCAGGG + Intronic
1057802600 9:98199259-98199281 GGGACATGTCCAAGGTCACATGG + Exonic
1057914386 9:99044466-99044488 GGTCTCTGTACAAGGTGGCAAGG + Intronic
1058114220 9:101066668-101066690 GGGATATGTCAAAGGAGCCCAGG - Intronic
1062197509 9:135282476-135282498 AGGCTCTGTGCCAGGTGCCAAGG + Intergenic
1062542276 9:137046745-137046767 GGGAGCTGTCCAAGGTGTTCAGG + Intergenic
1185702116 X:2238545-2238567 AGGATCTGTCCAGGGTCCCTGGG - Intronic
1186592942 X:10950569-10950591 GTGATTTGTCCAAGGTCACACGG - Intergenic
1187670794 X:21664431-21664453 GGAACTTGTCCAAGGTGCCATGG + Intergenic
1189462553 X:41253965-41253987 GAGATCTGTTCAAGGTCACAGGG + Intergenic
1189498322 X:41529773-41529795 AGGATCTGTTCAAGGGGCTAGGG - Intronic
1189922298 X:45914483-45914505 GGGATTTGTTCAAGGTCCCTGGG - Intergenic
1196345727 X:114655289-114655311 GGGATCAGACCAAGTTACCATGG + Intronic
1196602043 X:117612788-117612810 GGGAACTGACCAAGATGCCTAGG + Intergenic
1197274181 X:124459088-124459110 GGGGCAAGTCCAAGGTGCCATGG + Intronic
1200245804 X:154524544-154524566 GGGATCTTGCCATGTTGCCAAGG - Intergenic
1200248865 X:154541707-154541729 GGGATCTGCCCAAGGACACAAGG + Intronic
1201941050 Y:19460602-19460624 CAGATCTGTGAAAGGTGCCAGGG - Intergenic