ID: 1081812575

View in Genome Browser
Species Human (GRCh38)
Location 11:45922198-45922220
Sequence CTTCAGGTGCTCCGCGGCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 89}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812564_1081812575 17 Left 1081812564 11:45922158-45922180 CCGGGCCACCTGGACTGAGAGTG 0: 1
1: 0
2: 2
3: 20
4: 236
Right 1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 89
1081812563_1081812575 21 Left 1081812563 11:45922154-45922176 CCGGCCGGGCCACCTGGACTGAG 0: 1
1: 0
2: 1
3: 17
4: 195
Right 1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 89
1081812570_1081812575 9 Left 1081812570 11:45922166-45922188 CCTGGACTGAGAGTGGGGGAGTG 0: 1
1: 0
2: 0
3: 34
4: 323
Right 1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 89
1081812569_1081812575 12 Left 1081812569 11:45922163-45922185 CCACCTGGACTGAGAGTGGGGGA 0: 1
1: 1
2: 3
3: 34
4: 257
Right 1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 89
1081812562_1081812575 22 Left 1081812562 11:45922153-45922175 CCCGGCCGGGCCACCTGGACTGA 0: 1
1: 0
2: 0
3: 11
4: 162
Right 1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812575 Original CRISPR CTTCAGGTGCTCCGCGGCTC TGG Intronic
901628888 1:10638775-10638797 CCTCTGGTGCTCCGCGGCCGAGG - Exonic
922494006 1:226041881-226041903 CTCCAGGTGCTCGGCAGCCCAGG + Intergenic
1064028143 10:11865880-11865902 CTGGAGGTGCTGAGCGGCTCTGG - Intronic
1068955637 10:62817190-62817212 CTTCAGCTGCTGCGCGGAGCGGG + Intronic
1069839057 10:71327874-71327896 CTGGAGGTCCTCCCCGGCTCTGG + Intronic
1074615265 10:115061148-115061170 CTTCTGATGCTCCGTGGCTTGGG + Intergenic
1077103129 11:830885-830907 CTCCAGGTGCTCCGCAGCCTGGG - Exonic
1077416508 11:2426569-2426591 CTACAGGTGCCCCGCTGCCCTGG - Intergenic
1081812575 11:45922198-45922220 CTTCAGGTGCTCCGCGGCTCTGG + Intronic
1082035518 11:47642428-47642450 AGTCAGGTGCTCCTGGGCTCCGG - Exonic
1090375943 11:126289509-126289531 CTTCAGGTGATCCGCCGCCTTGG + Intronic
1091324113 11:134671261-134671283 CTTGAGGGGCTCAGCGGGTCGGG + Intergenic
1092126313 12:6077412-6077434 CATCAGCTGCTCTGCGTCTCGGG + Intronic
1093766044 12:22964061-22964083 CTACAGGTGCTCCTCGACTTCGG - Intergenic
1094473228 12:30822625-30822647 TTCCCGGAGCTCCGCGGCTCCGG + Intergenic
1096469187 12:51865565-51865587 CTGCGGGTGCTCTGTGGCTCTGG - Intergenic
1101482150 12:105108136-105108158 CTTCAGCTGCCCCGGGGCTTGGG + Intronic
1111940514 13:94602011-94602033 CTTCAGCAGCACCGCGGCCCAGG + Exonic
1118611374 14:67542930-67542952 CCTCAGGTGATCCTCGCCTCAGG + Intronic
1120160435 14:81139714-81139736 CTTCAGGTGCTCCAGGCCTTTGG - Exonic
1122025483 14:98872883-98872905 GTTCAGGTGCAGCTCGGCTCAGG - Intergenic
1122861650 14:104585189-104585211 CTTCAGGTTCTCCCCTGCCCTGG - Intronic
1123119458 14:105910013-105910035 CTTCAGGGGCTCTGAGGCTGTGG + Intergenic
1123124706 14:105938005-105938027 TATCAGGTGCTCGGTGGCTCAGG - Intergenic
1125535008 15:40437607-40437629 CTTCAGGTGCTCTGGGGGTTGGG + Intergenic
1138279415 16:55761550-55761572 CTTCAGGGGCTCTGGGGCACAGG + Intergenic
1138289114 16:55832127-55832149 CTTCAGGGGCTCTGGGGCACAGG - Intronic
1138813349 16:60176289-60176311 CTACAGGAGCTCAGCAGCTCAGG - Intergenic
1140833733 16:78774636-78774658 CATGAGGTGCTCCCAGGCTCCGG + Intronic
1142611071 17:1109394-1109416 CTTCCCGGGCTCCGGGGCTCGGG + Intronic
1143587762 17:7859265-7859287 CTTCAGGTACTCTACGGCCCCGG - Intronic
1144578738 17:16446139-16446161 CTTCAGGTGATCCGCCCATCTGG + Intronic
1149292237 17:55228448-55228470 CATCAGGTTCTCTGGGGCTCTGG + Intergenic
1151414136 17:73950637-73950659 CTTCAGGCTCTCCGGGGCTGAGG + Intergenic
1151750450 17:76034245-76034267 CCTCAGGTGATCCGCAGCTTCGG - Intergenic
1154980622 18:21499864-21499886 CTTCAGAGTCTCCCCGGCTCCGG - Exonic
1158678979 18:59549504-59549526 CATCTGGTGCACCGGGGCTCAGG + Intronic
1160911546 19:1476186-1476208 CGTCAGGGGCCCCTCGGCTCTGG + Intronic
1163598299 19:18233093-18233115 CCACAGGTGCTTCGGGGCTCTGG + Exonic
1163761236 19:19137857-19137879 CTTCAGGTCTCACGCGGCTCTGG - Intronic
1163830333 19:19544494-19544516 CTGCAGCTGCTCCGCGGAGCCGG - Exonic
1164411716 19:28011811-28011833 CTCCAGGTGCTCCTTGGCTTGGG - Intergenic
1165236872 19:34428640-34428662 CTCCAGGGGCTCTGAGGCTCAGG + Intronic
1168332629 19:55579061-55579083 CTCCCGGGGCTCCGCGGCGCTGG + Exonic
927684364 2:25160578-25160600 GCTCAGGGGCTCCCCGGCTCCGG - Intergenic
934854981 2:97724089-97724111 CTTCAGGTGCTCCTCGGCCTCGG - Exonic
937065249 2:119012547-119012569 CTTCAGGGGCTCTGGGCCTCTGG - Intergenic
944684095 2:202102989-202103011 CTTCAGGGGCTCCAAGACTCTGG - Exonic
944688560 2:202139388-202139410 CCTCAGGTTCTCCGAGGCCCTGG - Intronic
948587209 2:239026912-239026934 CTGCAGGTGCTCCGGGACTGTGG - Intergenic
1170568617 20:17620669-17620691 CTTCATGTGCTCCACGGCGCCGG + Intronic
1175378124 20:58543161-58543183 CTTCAGGTGCCCCCCGGGGCTGG - Intergenic
1176306444 21:5125958-5125980 CTTCAGCCCCTCCACGGCTCAGG + Exonic
1178487767 21:33029761-33029783 GATCAGGTGCTCCGCACCTCTGG + Intergenic
1179850615 21:44136072-44136094 CTTCAGCCCCTCCACGGCTCAGG - Exonic
1179902264 21:44400366-44400388 CTTCAGGTGCTGCAGGGCTGCGG + Exonic
1183745090 22:39687375-39687397 CTGCAGGTGCCCCTGGGCTCAGG + Exonic
1184222792 22:43111287-43111309 CCTCAGGTGCGCAGCGCCTCCGG - Intronic
1184788825 22:46686562-46686584 CTTCAGGTGATCCGCGGGAGGGG - Exonic
955987635 3:64591205-64591227 CTTCAGGTGATCCGCTGCCTTGG - Intronic
962708440 3:138066861-138066883 CTTCAGGTGCGCCGTGGCCCAGG - Intronic
965077798 3:164002000-164002022 CTTCAGCAGCTCCAGGGCTCTGG - Intergenic
968486962 4:867504-867526 CTTCAGGGCCTCCTCGGCCCAGG + Intronic
968486984 4:867575-867597 CTTCAGGGCCTCCTCGGCCCAGG + Intronic
968602013 4:1513893-1513915 CTCCAGCTGCTCCAAGGCTCAGG - Intergenic
968991672 4:3917448-3917470 CCTCAGGTGCTACCCGGCACTGG + Intergenic
972329085 4:38047238-38047260 TTTCAGGTGCTCCGCCTCCCGGG + Intronic
972639155 4:40910198-40910220 CTTCAGGTGATCCGCCGCCTCGG + Intronic
981617380 4:146655518-146655540 ATTCGGGTCCTCCGGGGCTCCGG - Intergenic
985533475 5:447717-447739 CTTGAGGTTCTCCACGGCTGCGG - Exonic
986333702 5:6736989-6737011 CCTCAGGGGCCCCGCGGCCCAGG - Intronic
990308633 5:54517891-54517913 CCTCAGGTGGGCCTCGGCTCGGG + Exonic
997732755 5:136192885-136192907 CTCCAGGTGCTGGGCGCCTCTGG + Intergenic
999314247 5:150574049-150574071 TTTCAGCTCCTCCGCGGCGCTGG - Intergenic
1002906180 6:1451041-1451063 CCCCAGGTGCTCCGCGGCTGAGG + Intergenic
1006026149 6:31148428-31148450 CCTCAGCTGCTCCTCGGCTGAGG + Exonic
1006441631 6:34057039-34057061 CTTCAGGTGCTCCCCGGGTTGGG - Intronic
1007495799 6:42259670-42259692 CTTGAGGGGCTCCTCGGCTTTGG + Exonic
1011149964 6:84260373-84260395 CTTCAAATGCTCAGCTGCTCTGG - Intergenic
1013261047 6:108442881-108442903 CTGCAGGTGCTAAGGGGCTCAGG - Intronic
1014100020 6:117501564-117501586 CTTCAGGTGATCCGCTGCCTTGG + Intronic
1015773592 6:136792483-136792505 CTTGAGCTGCACCGCGGCGCAGG - Exonic
1019667982 7:2261895-2261917 ACTCAGGAGCTCCGGGGCTCAGG + Intronic
1029788613 7:102819106-102819128 CTTCAGGTTCTCTGTGGTTCAGG + Intronic
1035026824 7:155831657-155831679 CTTCATATCCTGCGCGGCTCGGG + Intergenic
1036635504 8:10547564-10547586 CTCCCGGTGCTCTGCTGCTCCGG + Intronic
1040918285 8:52586711-52586733 CTTAACGTGCTCAGCGGCACAGG - Intergenic
1042456467 8:69010659-69010681 CTACAGCTGCTCAGAGGCTCTGG - Intergenic
1043413688 8:80027623-80027645 CTTCAGTTGCTCCCTGGTTCAGG - Intronic
1050670373 9:7989922-7989944 CTTCAGGTGATCCGCTGCCTTGG + Intergenic
1052785904 9:32828142-32828164 CTTCAGCTGCTCCAAGGCTCCGG - Intergenic
1056381012 9:86057506-86057528 CCTCAGCTGCACCCCGGCTCGGG - Intronic
1061570454 9:131474887-131474909 CTGCTGGAGCTCCGGGGCTCGGG - Exonic
1189487145 X:41442643-41442665 CATCTGGTGCCCCGGGGCTCAGG - Intergenic
1197766427 X:130062044-130062066 CCCCAGGTGCTCCACTGCTCTGG - Intergenic
1200257501 X:154592065-154592087 CTTCAGGTTCCCTGCAGCTCAGG - Intergenic