ID: 1081812852

View in Genome Browser
Species Human (GRCh38)
Location 11:45923027-45923049
Sequence ACACGTGGCATGAGCGGGCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 82}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812852_1081812866 19 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812852_1081812872 30 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812852_1081812869 28 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812852_1081812871 29 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812852_1081812859 -7 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812859 11:45923043-45923065 CACGTGTCCCCCCAGACGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1081812852_1081812868 27 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812852_1081812857 -10 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812857 11:45923040-45923062 TGCCACGTGTCCCCCCAGACGGG 0: 1
1: 0
2: 0
3: 2
4: 99
1081812852_1081812860 -1 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812852 Original CRISPR ACACGTGGCATGAGCGGGCC GGG (reversed) Exonic
901633814 1:10660436-10660458 ACACGCGGGACGAGCTGGCCAGG - Exonic
901666071 1:10826998-10827020 ACACGTAGCATGCTCGGCCCAGG - Intergenic
902774385 1:18665330-18665352 AGATATGGCATGAGCGGGCTCGG + Intronic
902822443 1:18951481-18951503 ACACTAGGCCTGAGGGGGCCAGG + Intronic
903997927 1:27319470-27319492 AAACGTGGCATGAGGAGGGCCGG - Intergenic
909023231 1:70454955-70454977 ACACCTGGCCTGATCAGGCCGGG + Intergenic
922763164 1:228144800-228144822 ACACGTGGCAGGTGAGGGCCCGG - Intronic
1066476218 10:35749680-35749702 ACAGGAGGCATGAGGAGGCCTGG - Intergenic
1070798633 10:79231866-79231888 ACACCAGGCATGACCGGGCACGG - Intronic
1073564762 10:104525672-104525694 ACTGGGGGCATGAGAGGGCCTGG - Intergenic
1080832039 11:35903711-35903733 AAAAGGGGCATGAGGGGGCCGGG + Intergenic
1081812852 11:45923027-45923049 ACACGTGGCATGAGCGGGCCGGG - Exonic
1084185584 11:67469196-67469218 GCACGGCGCCTGAGCGGGCCGGG - Exonic
1084735467 11:71102705-71102727 TCTCTTGGCATGAGCCGGCCTGG - Intronic
1096976007 12:55699610-55699632 TCAGGTGGAATGAGAGGGCCAGG - Intronic
1104785017 12:131443781-131443803 ACACGTGGCCACAGCGGGCCTGG - Intergenic
1107141287 13:37000706-37000728 TCCCGTGGCGTGAGCGGCCCCGG + Exonic
1113313399 13:109154324-109154346 AAACGTGGCAGGCCCGGGCCAGG - Intronic
1121230848 14:92356871-92356893 GCACGTGCCATGAGGGGGTCTGG - Intronic
1121234577 14:92383031-92383053 ACACGTGGCCAGTGGGGGCCTGG - Intronic
1121630245 14:95416607-95416629 ACACCTGGCTGGAGAGGGCCTGG + Intronic
1123054955 14:105564910-105564932 ACACGTGGCATTGCTGGGCCAGG - Intergenic
1123079397 14:105684489-105684511 ACACGTGGCATTGCTGGGCCAGG - Intergenic
1124369112 15:29093335-29093357 ACAGGGGGCAGGAGCGGCCCAGG + Intronic
1124832967 15:33167174-33167196 CCACGTGTCATGGGCAGGCCAGG + Intronic
1128699547 15:69794282-69794304 ACACGAGACCTGAGGGGGCCTGG + Intergenic
1131228805 15:90646021-90646043 CCACGTGGCAGGAGAGGGCTGGG - Intergenic
1134853135 16:17498335-17498357 ATACGTGGCATCAGCATGCCTGG - Intergenic
1136626392 16:31464698-31464720 GCACGTGGGCTGGGCGGGCCCGG - Exonic
1136996047 16:35188680-35188702 ACACTTGGCATAGGCAGGCCAGG - Intergenic
1139664492 16:68447029-68447051 AAACGTGCCAGGAGCGGGGCGGG - Intronic
1141691647 16:85600124-85600146 CCACGTGGATGGAGCGGGCCTGG - Intergenic
1142165001 16:88581743-88581765 CCACATGGCATGAGTGGGTCAGG - Intronic
1144119014 17:12131538-12131560 AAATGTGGCTAGAGCGGGCCGGG - Intronic
1148053229 17:44779437-44779459 GGACGTGGCCTGAGCGGGCGAGG - Intronic
1150209398 17:63433938-63433960 ACACGTGGCACAAATGGGCCCGG - Exonic
1152919462 17:83058756-83058778 ACATGGGGCATGAGAGGGGCCGG + Intergenic
1155963961 18:32019007-32019029 ACACGTGGCCACAGCGGGTCCGG - Exonic
1161068951 19:2251027-2251049 ACACGGGGCAGGAGCGGGCGGGG + Intronic
1162019432 19:7862008-7862030 ACACCTGGCAGGTGAGGGCCGGG + Exonic
1163769288 19:19180897-19180919 AAAAGTGGGATGAGTGGGCCAGG + Intronic
1166820871 19:45578999-45579021 ACCTGAGGCATGAGCGTGCCTGG - Intronic
925922212 2:8645543-8645565 ACCCGTGGCCTGGGCTGGCCTGG - Intergenic
927853803 2:26515825-26515847 GCACGTGGAATGAGCTGTCCTGG + Intronic
932047247 2:68362195-68362217 ACACGTGGCAGGAGGGGGAGGGG + Intergenic
933206277 2:79512493-79512515 ACACGTGGCAGGAGGAGGGCAGG - Intronic
935675853 2:105594620-105594642 ACAGGTGGCTTGAGCGTACCAGG + Intergenic
938221964 2:129576807-129576829 ACACATGGCATGAGAAAGCCAGG + Intergenic
940849048 2:158671140-158671162 ACACCTGTTATGAGCAGGCCAGG - Intronic
941448335 2:165628769-165628791 ACACTAGGGATGAGGGGGCCGGG + Intronic
947156297 2:227165002-227165024 ACAGGTGGAATGCGCGGGGCTGG + Intronic
948135516 2:235633296-235633318 AAATAGGGCATGAGCGGGCCGGG + Intronic
1170834031 20:19868520-19868542 ACACGTGAAATGAGCAGGGCAGG + Intergenic
1175826773 20:61940805-61940827 ACAGGTGTGAGGAGCGGGCCTGG - Intergenic
1180972734 22:19823964-19823986 GCAGGTGGCATGTGGGGGCCGGG - Intronic
1181721830 22:24781145-24781167 ACAAATGGCATGAGCAGGGCCGG - Intergenic
1183466277 22:37981922-37981944 ACACATGGCAAGAACAGGCCAGG + Intronic
1185167865 22:49272767-49272789 ACACGCGCCATGATCTGGCCTGG - Intergenic
949875069 3:8621239-8621261 ACAGGTGGCATGATTGGCCCAGG + Intronic
956164236 3:66384399-66384421 ACAGGTGGCAGGAGTGGTCCTGG - Intronic
961373506 3:126447287-126447309 ACACTTGTCATGAGTGAGCCTGG + Intronic
965610329 3:170536893-170536915 ACACATGGCATGAAGGTGCCAGG - Intronic
969605360 4:8199695-8199717 GCCCTTGGCATGAGCGGCCCTGG + Intronic
970177401 4:13353371-13353393 ACATGTGTCATGAGTGGCCCAGG + Intergenic
983969267 4:173851168-173851190 ACACATGGCAGGAGGGGGCAAGG - Intergenic
984647383 4:182234115-182234137 ACAGGTGCCATGAGGGAGCCAGG - Intronic
985815491 5:2125198-2125220 AAACGTGGCATGAAGGGGCATGG - Intergenic
986211962 5:5682449-5682471 ACACGTGGGCTGAGGAGGCCTGG + Intergenic
986345885 5:6834745-6834767 TCAAGTGGCAGGAGAGGGCCTGG - Intergenic
999082711 5:148859181-148859203 ACTCTTGGCATGAGCAGACCGGG - Intergenic
1011241572 6:85277161-85277183 AGACCTGGCAGGAGTGGGCCAGG - Intergenic
1013661503 6:112301866-112301888 ATAGGTGGCATGAACCGGCCTGG - Intergenic
1019623031 7:2001861-2001883 ACAGGTGGCATGCGCCGGCGGGG - Intronic
1020061479 7:5155795-5155817 CCACGTGTCAAGAGCGGGACAGG - Intergenic
1029635014 7:101777837-101777859 ACACTTGGGATGTGAGGGCCTGG + Intergenic
1035567263 8:649902-649924 AGACGTGACAGGACCGGGCCTGG + Intronic
1042274255 8:66986514-66986536 ACACGTGACCAGAGTGGGCCGGG + Intronic
1055877209 9:80957703-80957725 GCACGTGGAATGAGCAGGCATGG - Intergenic
1056803258 9:89708632-89708654 TCAGGCGGCATGAGCTGGCCTGG - Intergenic
1060221935 9:121768730-121768752 CCAAGTGGCATGATCAGGCCAGG + Intronic
1062200394 9:135299836-135299858 ACACGTGGCGAGAGCGTGACTGG + Intergenic
1062444821 9:136589194-136589216 CCACGTGGCATGTCCAGGCCAGG - Intergenic
1195171646 X:102274238-102274260 AAAGGGGGCATGTGCGGGCCAGG + Intergenic
1195187214 X:102412861-102412883 AAAGGGGGCATGTGCGGGCCAGG - Intronic
1195378540 X:104250433-104250455 ACACGCGCCATGGGCGGCCCGGG + Exonic
1195378549 X:104250460-104250482 ACACGCGCCATGGGCGGCCCGGG + Exonic