ID: 1081812853

View in Genome Browser
Species Human (GRCh38)
Location 11:45923028-45923050
Sequence GACACGTGGCATGAGCGGGC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 65}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812853_1081812859 -8 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812859 11:45923043-45923065 CACGTGTCCCCCCAGACGGGAGG 0: 1
1: 0
2: 0
3: 2
4: 72
1081812853_1081812869 27 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812853_1081812868 26 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812853_1081812871 28 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812853_1081812860 -2 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812853_1081812872 29 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812853_1081812866 18 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812853 Original CRISPR GACACGTGGCATGAGCGGGC CGG (reversed) Exonic
900487569 1:2930654-2930676 GACACGTGCCATGCGCAGCCCGG - Intergenic
903945277 1:26959109-26959131 GACACCTAGCAAGAGAGGGCTGG + Intronic
906287625 1:44598032-44598054 GGCAGGGGGCATGAGGGGGCTGG - Intronic
907735855 1:57111223-57111245 AACACGTGGCCTGTGAGGGCTGG - Intronic
913255748 1:116951734-116951756 GACACTTGTCAGGAGCGGGTAGG + Intronic
917964270 1:180168467-180168489 GCCAAGTGGCTTGAGCTGGCAGG + Intronic
917968623 1:180193813-180193835 GACAGGCAGCATGAGTGGGCAGG + Intronic
924090684 1:240497780-240497802 GACACTTGGCCTGAGCCAGCTGG - Intronic
1067455393 10:46415562-46415584 GACACGTGGAAAGATCGTGCAGG - Intergenic
1067631810 10:47969073-47969095 GACACGTGGAAAGATCGTGCAGG + Intergenic
1071334379 10:84589255-84589277 GACACCAGGGATGAGGGGGCTGG - Intergenic
1072540320 10:96393585-96393607 GACACCAGGCATGTGCAGGCTGG + Intronic
1078860131 11:15239159-15239181 GACACAGGGCAAGAGCTGGCTGG + Intronic
1081812853 11:45923028-45923050 GACACGTGGCATGAGCGGGCCGG - Exonic
1083705603 11:64512216-64512238 AACAGGGGGCAGGAGCGGGCAGG - Intergenic
1083950082 11:65949362-65949384 GACAGGAGGCATGTGAGGGCAGG + Intronic
1084884134 11:72192324-72192346 GACAAGTTGCATGAGCAGGTGGG + Exonic
1085339033 11:75719398-75719420 GACAAGAGGCAGGAGCGGGAGGG + Intronic
1085397230 11:76212801-76212823 GGCAGGTGGCAGGAGGGGGCAGG - Intergenic
1089098509 11:115939828-115939850 GGCAGGTGGCAGGGGCGGGCAGG + Intergenic
1089783942 11:120894795-120894817 CACACGTGCCAGGAGTGGGCAGG - Intronic
1097995671 12:65885662-65885684 GATACGTGGCATGTGCTGTCAGG - Intronic
1101714464 12:107298394-107298416 GACACATGGCAGGACAGGGCTGG - Intergenic
1104479733 12:129097045-129097067 GGCACGTGGCAAGAGCGGCTTGG - Intronic
1104959340 12:132480824-132480846 GGCACGGTGCATGAGCGGGCCGG + Intergenic
1110923574 13:81120617-81120639 GACATGTGCTATGAGAGGGCAGG - Intergenic
1113593624 13:111517270-111517292 GACACGAGGCCTGAGCTGCCTGG - Intergenic
1123997813 15:25731023-25731045 GACACCAGGCAGGAGGGGGCAGG + Intronic
1124578421 15:30929320-30929342 GCCACGTGGCATGAGCAGGAAGG + Exonic
1129728421 15:77915818-77915840 GACAGATGGCATGAGTGAGCAGG - Intergenic
1130540241 15:84817039-84817061 CACACGGGACATGAGCAGGCCGG + Exonic
1131228807 15:90646022-90646044 CCCACGTGGCAGGAGAGGGCTGG - Intergenic
1138330729 16:56213460-56213482 GGCAAGGGGCATGAGCGGGAGGG + Intronic
1139664493 16:68447030-68447052 GAAACGTGCCAGGAGCGGGGCGG - Intronic
1141702086 16:85647169-85647191 GACAGGGGGCATGGACGGGCAGG - Intronic
1144119015 17:12131539-12131561 GAAATGTGGCTAGAGCGGGCCGG - Intronic
1157294320 18:46431660-46431682 GACCCGAGGCAGGAGAGGGCAGG - Intronic
1161068950 19:2251026-2251048 GACACGGGGCAGGAGCGGGCGGG + Intronic
1162019431 19:7862007-7862029 GACACCTGGCAGGTGAGGGCCGG + Exonic
1165894542 19:39133730-39133752 GACAGGTGGCAGGAGCAGGGAGG - Intronic
929978598 2:46658030-46658052 GACACGTGGGAGGACCAGGCTGG + Intergenic
932047246 2:68362194-68362216 GACACGTGGCAGGAGGGGGAGGG + Intergenic
934098514 2:88628943-88628965 GACACGTGGTAGGAGCTGGAAGG - Intergenic
939505315 2:143038791-143038813 TACACGTGGCATGTGTAGGCAGG - Intronic
948607663 2:239146467-239146489 GACACGTGGCATCGGGAGGCGGG + Intronic
948786840 2:240357146-240357168 GGCAAGTGGCATGGGCGGGGAGG + Intergenic
1168904068 20:1390214-1390236 GACACCTGGCAAGAGCTGACTGG + Intronic
1180972735 22:19823965-19823987 GGCAGGTGGCATGTGGGGGCCGG - Intronic
1183736385 22:39647042-39647064 GACAGGTGCCAGGAGAGGGCAGG - Intronic
1184429094 22:44430782-44430804 GACACGTGGTGTCAGCGGTCTGG - Intergenic
968476097 4:809512-809534 GACACATGGCCTGAGGGGGTGGG + Intronic
969313746 4:6369522-6369544 CACACGTGGCATGTGGAGGCAGG + Intronic
982725832 4:158904878-158904900 GACAAGTGACTTGAGCGGGGTGG + Exonic
991170455 5:63618807-63618829 GACACCTTGCATGAGAGGGAAGG - Intergenic
999572307 5:152933569-152933591 GACATGTGGCCTGAGAGGCCTGG - Intergenic
1001708718 5:173760988-173761010 GACAGGTGGCATGGGAGAGCAGG - Intergenic
1005959986 6:30687470-30687492 GACACCTGGCGTGTCCGGGCGGG - Exonic
1013458253 6:110351725-110351747 GTCAAGTGGCCTGAGCCGGCTGG + Intronic
1017975040 6:159349621-159349643 GTAACCTGGCATGAGTGGGCAGG + Intergenic
1018759271 6:166876731-166876753 AACACCTGGCATGAGTGGGGAGG + Intronic
1019623032 7:2001862-2001884 GACAGGTGGCATGCGCCGGCGGG - Intronic
1024294605 7:47832278-47832300 GACACGTGGCCTGGGCTGGAAGG - Intronic
1027162548 7:75813267-75813289 GGCACGTGGCAGGAGAGGGGTGG - Intronic
1031786537 7:126040763-126040785 GCCACTTGGCATGAACGGCCTGG + Intergenic
1035287285 7:157814495-157814517 GACACGGGGCAGGACGGGGCAGG + Intronic
1049436477 8:142588437-142588459 GACACGTGGCAGGGCCTGGCAGG - Intergenic
1049591761 8:143465950-143465972 GACACGCGGCACCAGCAGGCAGG + Intronic
1049689011 8:143950677-143950699 GTCCCGTGGCATGAGCATGCCGG + Exonic
1056122753 9:83505495-83505517 GACAGGTGGCCTGAGAGAGCTGG + Intronic
1058425630 9:104873498-104873520 GACATGGGGCATGGGCTGGCTGG - Intronic
1199548386 X:149032132-149032154 GCCACGTGGCATCAGGGGCCTGG - Intergenic