ID: 1081812854

View in Genome Browser
Species Human (GRCh38)
Location 11:45923032-45923054
Sequence GGGGGACACGTGGCATGAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 140}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812854_1081812871 24 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812854_1081812866 14 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812854_1081812875 29 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812854_1081812868 22 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812854_1081812860 -6 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812854_1081812869 23 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812854_1081812872 25 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812854 Original CRISPR GGGGGACACGTGGCATGAGC GGG (reversed) Exonic
900175628 1:1290247-1290269 TGGGGACAGGGGGGATGAGCAGG - Intronic
900984343 1:6064822-6064844 GGGGGACACTTGGGATCAGAGGG + Intronic
902816370 1:18918848-18918870 GGGGGACAGGTGGGGTGTGCCGG - Intronic
903127905 1:21260217-21260239 GGCGGGCAGGTGGCATGGGCCGG + Intronic
903769514 1:25755014-25755036 GGGGGCCTCCTGGCAGGAGCTGG + Intronic
903920929 1:26800137-26800159 TGGGTGCACCTGGCATGAGCTGG + Intergenic
905709223 1:40086601-40086623 GGGGGAGACCTGACCTGAGCTGG + Intronic
906684904 1:47757010-47757032 GGGGGACAAGGGGGCTGAGCAGG - Intergenic
908855017 1:68417174-68417196 GGGGTACATGTGACATGTGCAGG - Intergenic
911235629 1:95409196-95409218 GGGGGAAACGGGGCCAGAGCTGG - Intergenic
915328192 1:155092110-155092132 GGGGAACGAGGGGCATGAGCTGG + Intergenic
919570534 1:199242920-199242942 GGGGGACAAGGGCCATGTGCTGG - Intergenic
920386944 1:205576102-205576124 GGGGGACAAGAGGTAGGAGCAGG + Intronic
921301517 1:213755540-213755562 GTGGGCCAGGTGGCATGATCAGG + Intergenic
922221963 1:223615507-223615529 GGAGCACACAGGGCATGAGCTGG - Intronic
923106867 1:230861065-230861087 GGGGGGCGGGAGGCATGAGCAGG + Intronic
1063429549 10:5977214-5977236 GAGGGACACGTGCCGGGAGCCGG - Intronic
1067085471 10:43235770-43235792 GGGGGACACAAGGCATGGGATGG + Intronic
1071337070 10:84609233-84609255 GGGGGACACATGGAAAGAGCTGG + Intergenic
1071522148 10:86338046-86338068 GTGAGACACGTGGCTTGGGCTGG + Intronic
1072540319 10:96393581-96393603 GGGAGACACCAGGCATGTGCAGG + Intronic
1075679484 10:124322284-124322306 GTGGGACAGGAGGCATGAGCTGG + Intergenic
1077237502 11:1488748-1488770 GGGGGACACGTGCAGGGAGCAGG + Intronic
1077359746 11:2135538-2135560 GGGAGAGAAGTGGCGTGAGCGGG + Intronic
1081812854 11:45923032-45923054 GGGGGACACGTGGCATGAGCGGG - Exonic
1082709900 11:56541978-56542000 GGGTGAAACGTGGCATGCCCTGG - Intergenic
1084735468 11:71102710-71102732 AGGGGTCTCTTGGCATGAGCCGG - Intronic
1084884132 11:72192320-72192342 CGAGGACAAGTTGCATGAGCAGG + Exonic
1085048629 11:73368013-73368035 GGGGGACATGTGGGCTGACCAGG + Exonic
1085312892 11:75526322-75526344 GGGGGTCACGGGGAAGGAGCAGG + Intergenic
1085446286 11:76603331-76603353 CTGGGCCAAGTGGCATGAGCTGG + Intergenic
1090007718 11:123017586-123017608 GGCGGGCAGTTGGCATGAGCGGG + Intergenic
1094192183 12:27709132-27709154 GGGGGACAAATAGCATGAGATGG - Intergenic
1102396498 12:112590489-112590511 GGGGGACTCATGGAATGAGGAGG - Intronic
1104678541 12:130732305-130732327 CGGCGCCACGTGGAATGAGCAGG + Intergenic
1104718920 12:131033843-131033865 TGGGGACACGTGGTATCTGCAGG + Intronic
1115697934 14:35920695-35920717 GGGGGACACTTGGGATAAGGAGG - Intronic
1118755839 14:68843341-68843363 GGGGGTCACAGGGCAAGAGCAGG - Intergenic
1119411376 14:74433158-74433180 GGGGGGCTGGTGGAATGAGCAGG + Intergenic
1120848237 14:89145147-89145169 GAGAGAAATGTGGCATGAGCTGG + Intronic
1121442930 14:93959992-93960014 GGTGGACTCGTGGCATGGGGTGG - Intronic
1121644509 14:95508681-95508703 GAGAGAAACTTGGCATGAGCAGG + Intergenic
1122245719 14:100401940-100401962 GGGGTACAACTGGCATTAGCAGG + Intronic
1122865355 14:104601474-104601496 GGGGGACCCATGGCCTGAGATGG + Intronic
1123161803 14:106286235-106286257 GGGGGGCACGGGGCAGGATCGGG + Intergenic
1123538225 15:21261116-21261138 GGGGGCCAGGTGGTAGGAGCTGG - Intergenic
1124578420 15:30929316-30929338 GGCAGCCACGTGGCATGAGCAGG + Exonic
1124660674 15:31548486-31548508 GGAGGTCTCGTGGCATGGGCAGG + Intronic
1125549996 15:40538065-40538087 AGGGGACACTTGGCAGGAGAGGG - Intronic
1127373457 15:58361171-58361193 GGTGGGCAGGTGGCTTGAGCTGG - Intronic
1132303092 15:100788444-100788466 GTGGCAAAAGTGGCATGAGCTGG + Intergenic
1132590795 16:725583-725605 GTGGGACAACTGGCATGAGCAGG + Intronic
1132691753 16:1184687-1184709 GGAGGCCACGTGGCAGGAGGAGG + Intronic
1136541137 16:30928146-30928168 GGGGGACAGGTGAGGTGAGCTGG + Intronic
1137251888 16:46747198-46747220 GGGGGACAGCAGGCAGGAGCCGG - Intronic
1138522169 16:57577418-57577440 GGGGGACATGTGGCATGGCCTGG - Intronic
1141380862 16:83575506-83575528 GAGGGACACGTGGTGTGAGCAGG - Intronic
1141606039 16:85153980-85154002 GCTGGACACGTGGCTTGGGCGGG + Intergenic
1143163394 17:4885667-4885689 GGGGACCACGGGGCCTGAGCAGG + Intronic
1147285843 17:39401998-39402020 GGGGGACACGGGGCAGAAGAGGG - Intronic
1148811466 17:50295180-50295202 GGGGGACATGTGGCAGGCACTGG - Intergenic
1151871543 17:76840288-76840310 GGGGGACACGGGACAGGAGTGGG - Intergenic
1152278448 17:79371647-79371669 GGGGGACACGTGTCATCTCCAGG + Intronic
1156858617 18:41812045-41812067 GAGGGATACGTGGCATAATCGGG + Intergenic
1160721821 19:600922-600944 GGGTGAGAAGTGGCATGTGCGGG - Intronic
1160807969 19:1000892-1000914 GGGGGACCCGGGGCGGGAGCGGG + Intronic
1161068948 19:2251022-2251044 CCGGGACACGGGGCAGGAGCGGG + Intronic
1161456309 19:4371363-4371385 GGTGGCCACTTGGCAGGAGCAGG + Intronic
1161822150 19:6536284-6536306 GTTGGACACGTGACTTGAGCTGG + Intergenic
1162562136 19:11422951-11422973 GCAGGACAGGTGGCCTGAGCTGG + Intronic
1165077646 19:33289714-33289736 GGGGGTCCAGTGGCATGAGTGGG + Intergenic
1165118970 19:33546931-33546953 GGGGGCCAGGTGGCTTGAGCTGG - Intergenic
1165899395 19:39161763-39161785 GGAGGCCACGTGGCTGGAGCAGG - Intronic
1167769018 19:51502154-51502176 GGGGTGCAGGTGGGATGAGCAGG + Intergenic
925147215 2:1589188-1589210 GGGGGATTCGTGGTATGACCCGG - Intergenic
925744561 2:7033243-7033265 GCGGCCCACGTGGCATCAGCCGG + Intronic
927938096 2:27086576-27086598 GGGGGAGACGTCGCAGGAGCCGG - Intergenic
928380238 2:30811435-30811457 GGGGGAGACGTTGCATCAGCTGG - Intronic
932010431 2:67972218-67972240 AGGGGACACCTGGCTTGAGTTGG - Intergenic
933721588 2:85400731-85400753 GGGGGACAGCTGCCATGTGCTGG - Intronic
943473143 2:188320158-188320180 AGGGGACATTTGGCATCAGCTGG - Intronic
944997045 2:205305197-205305219 GGAGGACCAGTGACATGAGCTGG - Intronic
945943414 2:215972012-215972034 GGGTGATCCCTGGCATGAGCTGG - Intronic
948607661 2:239146463-239146485 GTGGGACACGTGGCATCGGGAGG + Intronic
1169226034 20:3857590-3857612 AGGGGCCACCTGGCTTGAGCAGG + Intronic
1170579014 20:17684035-17684057 GGTGGAGAAGTGGGATGAGCAGG + Intergenic
1175855430 20:62118464-62118486 GGGGGACAGGAGGCAGGAGGGGG + Intergenic
1175917668 20:62434446-62434468 GTGGGACACATGGCAGGAACAGG + Intergenic
1179613074 21:42564914-42564936 GGGGGACAGGAGGCATGAGAGGG - Intronic
1181949104 22:26541483-26541505 GGGGGCCATGCGGCCTGAGCAGG - Exonic
1184155504 22:42664132-42664154 GGAGGACAGGTGGCCTGAGATGG - Intergenic
1184794117 22:46721700-46721722 GGGAGACACGTGACAGGACCCGG + Intronic
953673476 3:44981912-44981934 GGGGGATCTGTGGCAAGAGCTGG + Intronic
954749539 3:52805884-52805906 GAGGGACATGTGGCAGGGGCAGG - Intronic
955166035 3:56512198-56512220 GGGGCACATGTGGCAATAGCTGG + Intergenic
958453460 3:94301959-94301981 GGGGGACACTTGGCAGTATCTGG + Intergenic
961573584 3:127817435-127817457 GAAGGCCAAGTGGCATGAGCCGG + Intronic
965556324 3:170021864-170021886 AGGGGACACCTAGCCTGAGCTGG - Intergenic
968660597 4:1797291-1797313 GTGTGACACGGGGCATGAGTGGG - Intronic
969184304 4:5464075-5464097 GTGTGTCACGTGGCAGGAGCAGG + Intronic
969453497 4:7288047-7288069 GGAGGCCGCATGGCATGAGCTGG - Intronic
969486577 4:7475546-7475568 GGGAGACAAGTGGCAGGAGGGGG - Intronic
973876650 4:55226812-55226834 GGGTGACAGGTGGCATGGACAGG - Intergenic
975516809 4:75257199-75257221 GGGGGAAATGTGGCAGGAGATGG - Intergenic
984689468 4:182708866-182708888 GTGGGACACACGGCATGAGTAGG - Intronic
985672418 5:1213431-1213453 GCGGGACATGTGGGATGGGCGGG - Intronic
985709723 5:1421580-1421602 GGGGGACACGTGGCCGTGGCTGG - Intronic
987432325 5:17850533-17850555 AGAGGAAACCTGGCATGAGCTGG + Intergenic
993329888 5:86586193-86586215 GGGGGACAGGTGGTAGAAGCAGG + Intergenic
996065193 5:119071514-119071536 CGCTGACCCGTGGCATGAGCTGG + Exonic
997653939 5:135541819-135541841 GGGGGAAACGAGGCAGGAGGGGG + Intergenic
998016714 5:138737874-138737896 TGGAGTCAGGTGGCATGAGCTGG - Intronic
1000911676 5:167030442-167030464 GGGGGTAACGGGGCAGGAGCAGG - Intergenic
1002780504 6:361570-361592 GGTGGGTACGTGGCATCAGCTGG - Intergenic
1003946907 6:11084361-11084383 GGGGGAGATCTGGCAGGAGCTGG - Intergenic
1004003857 6:11621448-11621470 GGGAGACAGGTGGCATGTGCAGG - Intergenic
1005594662 6:27368034-27368056 GGGGGAAAGGTGGCAGGGGCTGG - Intergenic
1006453780 6:34120644-34120666 GGGGGTGATGTGGCAGGAGCTGG - Intronic
1010956678 6:82098257-82098279 GATGGACACTTGGCATGATCAGG + Intergenic
1013479703 6:110543245-110543267 AGGGGAGAGCTGGCATGAGCAGG - Intergenic
1016433152 6:144008454-144008476 GGGCGTCACGTGGCAGGAGGAGG + Intronic
1018358776 6:163044768-163044790 GCGGGAGAGGTGTCATGAGCAGG + Intronic
1018471249 6:164100446-164100468 AGGGGGCACGTGGACTGAGCAGG - Intergenic
1018868529 6:167763756-167763778 AAGGGACACTTGGAATGAGCAGG + Intergenic
1019540652 7:1549711-1549733 CGGGGGCACCTGGCATGAGGTGG - Intronic
1019540688 7:1549816-1549838 CGGGGACACCTGGCATGAGGTGG - Intronic
1022077052 7:26982128-26982150 GGGGGTCAGCTGGCATGAGAAGG - Intronic
1022144350 7:27522194-27522216 GGGGGACACATGGCAATGGCTGG - Intergenic
1023118920 7:36889908-36889930 GGTGGGCACCTGCCATGAGCCGG - Intronic
1024098609 7:46006343-46006365 GGAGTACATGTGGCATGAGAAGG - Intergenic
1025782237 7:64612032-64612054 GTGAAACAGGTGGCATGAGCAGG + Intergenic
1027202798 7:76073766-76073788 GGCCGACACGAGGCAAGAGCGGG + Intergenic
1030721686 7:112878643-112878665 GGGAAACACTAGGCATGAGCTGG + Intronic
1032085436 7:128881091-128881113 GGGGGAGACATGGGATGGGCAGG + Intronic
1032190506 7:129762752-129762774 GGTGGACACGTGGTCTCAGCCGG - Intergenic
1032479740 7:132236749-132236771 GGGAGACAGGTGGCAAGAGTGGG - Intronic
1035338789 7:158147304-158147326 GAAAGACACGTGGCATGAGATGG - Intronic
1035338862 7:158147646-158147668 GAAAGACACGTGGCATGAGATGG - Intronic
1035339154 7:158149052-158149074 GAATGACACGTGGCATGAGATGG - Intronic
1036629496 8:10500774-10500796 GGAGGAGATGGGGCATGAGCTGG + Intergenic
1036791885 8:11726514-11726536 GGGGGACAGGTGGCAGTGGCTGG + Intronic
1039984566 8:42436686-42436708 GGCGGCCACGTGGCGTCAGCAGG - Intronic
1043082608 8:75784820-75784842 GGGGGCCAGGTGGCAGGGGCTGG + Intergenic
1046811784 8:118540917-118540939 GGTGGACATGTGACCTGAGCAGG + Intronic
1048889673 8:138936226-138936248 AGGGGACACATGGGCTGAGCAGG + Intergenic
1049581986 8:143416839-143416861 GGGGGACTCAGGGCATGGGCAGG + Intergenic
1053613470 9:39739840-39739862 AGGGGGCACGTGGCTTGAACTGG + Intergenic
1053871511 9:42497797-42497819 AGGGGGCACGTGGCTTGAACTGG + Intergenic
1054240044 9:62602557-62602579 AGGGGGCACGTGGCTTGAACTGG - Intergenic
1054554177 9:66637083-66637105 AGGGGGCACGTGGCTTGAACTGG - Intergenic
1056120623 9:83484338-83484360 AGGGGAAATGTGGCAAGAGCCGG + Intronic
1056987850 9:91380727-91380749 GGGGCACATGTTGCATGAGCAGG + Intergenic
1060221668 9:121767365-121767387 GGGAGACGTGTGGAATGAGCAGG + Intronic
1195588650 X:106598359-106598381 GGGAAAGACGTGGCATGAGAAGG - Intergenic