ID: 1081812855

View in Genome Browser
Species Human (GRCh38)
Location 11:45923033-45923055
Sequence GGGGGGACACGTGGCATGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812855_1081812860 -7 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812855_1081812871 23 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812855_1081812866 13 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812855_1081812869 22 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812855_1081812868 21 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812855_1081812872 24 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812855_1081812875 28 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812855 Original CRISPR GGGGGGACACGTGGCATGAG CGG (reversed) Exonic
900421882 1:2559308-2559330 GGGGGCACAGGTGGCAGGTGAGG + Intronic
900984342 1:6064821-6064843 AGGGGGACACTTGGGATCAGAGG + Intronic
901270428 1:7948919-7948941 TGGGGAACATGAGGCATGAGGGG + Intergenic
904842095 1:33379356-33379378 GGGGGGACAGGGGGGATGGGGGG - Intronic
905864371 1:41368659-41368681 GGGGGGCCAGGTGGCGTGTGGGG + Intronic
905914460 1:41675237-41675259 AGGGGGAGATGTGGCAGGAGGGG - Intronic
906287627 1:44598037-44598059 GGGCGGGCAGGGGGCATGAGGGG - Intronic
913186286 1:116373286-116373308 AGGCGGACACGTGGCAACAGCGG + Intronic
915111533 1:153567047-153567069 GGGAAGACAAGTAGCATGAGGGG - Intronic
917965469 1:180175985-180176007 TGGGGGCCACGTGTCATGATGGG - Exonic
918063764 1:181085573-181085595 GGAGGGACACTGGGCATGACAGG + Intergenic
920230453 1:204466516-204466538 GTGGGGACAGTTGGCATGTGAGG + Intronic
920562193 1:206946853-206946875 TGGGGCACAGGTGGCAGGAGTGG + Intergenic
923035394 1:230281616-230281638 GGGTAGACACGTGGGATGATAGG - Exonic
923792145 1:237120884-237120906 AGGGAGGCACATGGCATGAGGGG - Intronic
1064226488 10:13490459-13490481 GGAGGGACACGGGGACTGAGTGG - Intronic
1064262955 10:13800699-13800721 GTGGGGACATGTCGCATGAAGGG + Intronic
1073287535 10:102397719-102397741 GGTGGCAGAGGTGGCATGAGGGG + Intronic
1073545594 10:104346106-104346128 GGTGTGTCACGTGGCAAGAGAGG + Intergenic
1075391390 10:122095119-122095141 GGGGGGAAACTTGCCATCAGGGG - Intronic
1075682411 10:124342226-124342248 GGTGGGTCACTGGGCATGAGTGG - Intergenic
1076393316 10:130120159-130120181 GGGGTCTCACGTGGCAAGAGAGG + Intergenic
1076668563 10:132106460-132106482 GGAGGGACTCATGGCAGGAGGGG - Intronic
1076682636 10:132181857-132181879 GGGAGGCCACGTGGGCTGAGGGG - Intronic
1079729429 11:23921419-23921441 TGGGGGAAAGGTGGCATCAGGGG + Intergenic
1081812855 11:45923033-45923055 GGGGGGACACGTGGCATGAGCGG - Exonic
1083955096 11:65978577-65978599 CTGGGGACGCGGGGCATGAGAGG - Intronic
1085455194 11:76661526-76661548 GGGGAGACAGCTGGCATAAGTGG + Intronic
1089297772 11:117480378-117480400 GGCAGGACACGTGGCACAAGGGG + Intronic
1089603650 11:119629291-119629313 GAAGGGACAGGTGGCAGGAGGGG + Intronic
1089684264 11:120137063-120137085 GGGGGGACAGGGGGCATGAGGGG + Intronic
1089845832 11:121457352-121457374 GGGTGAACAGGGGGCATGAGAGG - Intronic
1089892865 11:121898701-121898723 GGGGGGCCACGTAGCATGTGTGG + Intergenic
1090944968 11:131421399-131421421 GGGGGGAGAGGAGGCATCAGAGG + Intronic
1091495927 12:972805-972827 GGGGGCACACCTGGCATGGTTGG + Intronic
1092077245 12:5684117-5684139 GGAGGGACACCTGGCATGAAGGG - Intronic
1096595289 12:52691298-52691320 GGCGGGGCACGAGGCAGGAGTGG - Exonic
1103568630 12:121829949-121829971 TGGGGGTCACGTGGCATGTCAGG + Intronic
1103804739 12:123563481-123563503 GGGGGCACAGGTGGGATGAATGG + Intergenic
1108260298 13:48649056-48649078 GGGGGGACGCCAGGGATGAGTGG + Intergenic
1113306027 13:109079608-109079630 CTAGGGACACGGGGCATGAGTGG + Intronic
1113802830 13:113095420-113095442 CGGAGGCCACGTGGCAGGAGGGG + Intronic
1117933382 14:60872166-60872188 GCAGGCACACGTGGCAAGAGAGG + Intronic
1119265149 14:73259962-73259984 GGGAGGGCACCTGGCAGGAGTGG - Intronic
1120718528 14:87865997-87866019 GAGGGAAAACGTGGCCTGAGAGG - Intronic
1121652067 14:95566078-95566100 GGAAGGACACATGGGATGAGTGG + Intergenic
1122534861 14:102455063-102455085 GGGGAGAAACCTGGCTTGAGTGG + Intronic
1124904066 15:33852048-33852070 TGGGGGAGAGGCGGCATGAGAGG + Intronic
1125549997 15:40538066-40538088 AAGGGGACACTTGGCAGGAGAGG - Intronic
1128703688 15:69822453-69822475 GGGGGCACTGTTGGCATGAGGGG + Intergenic
1129232662 15:74205406-74205428 GGCAGGACACTTGGCAAGAGAGG + Intronic
1129435400 15:75535717-75535739 GGGGGGAAACAGGTCATGAGAGG - Intronic
1131233044 15:90673496-90673518 GGAGAGACAGGTGGCAGGAGGGG + Intergenic
1132652343 16:1027241-1027263 AGGGCGGCACGTGGCCTGAGAGG - Intergenic
1132730954 16:1361847-1361869 GGGGACACAGATGGCATGAGGGG - Intronic
1141278910 16:82613105-82613127 GGGGCGATAAGTGGCATGATTGG - Intergenic
1141606038 16:85153979-85154001 GGCTGGACACGTGGCTTGGGCGG + Intergenic
1142595025 17:1025695-1025717 GGGGGGATGCCTGGCTTGAGAGG - Intronic
1143400143 17:6638252-6638274 GGGGGGACCCGTGGCTCGGGAGG - Intronic
1143625464 17:8108087-8108109 GAGGGGCCACGTGGCAGGACAGG + Intronic
1143955341 17:10663646-10663668 GGGGGGACACAGGACAGGAGGGG + Intergenic
1144221653 17:13105315-13105337 GGGGGGACACATTACATGAGGGG - Intergenic
1145274575 17:21422035-21422057 GGGGGGACATGTGGAATGTCAGG - Intergenic
1145748259 17:27336518-27336540 AGGGGGACAGGTGACAGGAGGGG - Intergenic
1146786823 17:35728472-35728494 GGTGGGAGAAGTGGGATGAGTGG - Intronic
1147285844 17:39401999-39402021 AGGGGGACACGGGGCAGAAGAGG - Intronic
1148397920 17:47324685-47324707 TGAGGGAAATGTGGCATGAGAGG + Intronic
1149244960 17:54695027-54695049 GGGGAGCTACGTGGGATGAGCGG + Intergenic
1151408149 17:73902688-73902710 GGGGGCACACGGGGAATCAGAGG - Intergenic
1151712003 17:75812407-75812429 GGGTGGAGAGGGGGCATGAGGGG - Intronic
1151871544 17:76840289-76840311 TGGGGGACACGGGACAGGAGTGG - Intergenic
1151952514 17:77363017-77363039 GCGGGGAGAAGTGGCGTGAGAGG + Intronic
1152541278 17:80977503-80977525 GGGGGGAGAGGAGGAATGAGGGG + Intergenic
1153485869 18:5597179-5597201 GGAGGGTCTGGTGGCATGAGGGG - Intronic
1153944077 18:10003529-10003551 GGGGAGACAGGTGGCTTGGGAGG - Intergenic
1157443750 18:47729585-47729607 GGGGGGACACAAAGCAGGAGAGG + Intergenic
1157612855 18:48969170-48969192 GGGTGGACACAGAGCATGAGTGG + Intergenic
1159985016 18:74831721-74831743 AGGGGGACACGTGGCATCGACGG - Intronic
1160231507 18:77052847-77052869 GGGGGTATACATGGCGTGAGGGG - Intronic
1160721822 19:600923-600945 GGGGTGAGAAGTGGCATGTGCGG - Intronic
1160844209 19:1159494-1159516 GGGGGGACAGGGGGCAGCAGGGG + Intronic
1161139410 19:2638672-2638694 GGGGGTGCTCCTGGCATGAGTGG - Intronic
1161401252 19:4067011-4067033 GGGCAGAGACGTGGCAAGAGGGG - Intergenic
1162402362 19:10453937-10453959 GGAGGGACACTTGGCAGGAGGGG - Intronic
1162495192 19:11019528-11019550 GGGTGGCCAGGTGGCAAGAGGGG - Intronic
1162909507 19:13841726-13841748 TGGGGGACCCCTGGCATAAGGGG - Intergenic
1164650235 19:29886138-29886160 GGGGGGCCACGTGGAAAGATGGG - Intergenic
1164684525 19:30158120-30158142 GGGGGGACATGGGGAATGGGGGG + Intergenic
1165077645 19:33289713-33289735 TGGGGGTCCAGTGGCATGAGTGG + Intergenic
1166137800 19:40787684-40787706 GAGGGGTCAGGTGGGATGAGGGG + Intronic
1166549754 19:43657388-43657410 GGAGGGAGACGAGGCAGGAGAGG - Intronic
925119890 2:1409984-1410006 GGGGGGACAGGTGCCGTGAGGGG + Intronic
927648896 2:24899014-24899036 AGGGTGACAAGGGGCATGAGGGG - Intronic
927937525 2:27084014-27084036 GAGGGGACAAAAGGCATGAGGGG + Intronic
928437359 2:31263548-31263570 GGAGGGACAGGAGGAATGAGAGG + Intronic
932047243 2:68362189-68362211 GCGATGACACGTGGCAGGAGGGG + Intergenic
932407230 2:71521666-71521688 GGGGAGACACGAGGCATGGCAGG - Intronic
937862106 2:126719279-126719301 GGGGGGACGCCTGGGAGGAGTGG - Intergenic
948463997 2:238143527-238143549 GGCGGGAAAGGAGGCATGAGGGG + Intronic
1172032871 20:31994034-31994056 GTTGGGAGAAGTGGCATGAGAGG + Intronic
1173926447 20:46784704-46784726 GGGGAGACACGTGGCAGGTTTGG + Intergenic
1174883290 20:54304228-54304250 ATGGGGGCACTTGGCATGAGTGG - Intergenic
1175138495 20:56842581-56842603 GGGGGCCGAGGTGGCATGAGGGG - Intergenic
1175237731 20:57525636-57525658 GGGGGGAGGGGTGGAATGAGGGG + Intronic
1175812972 20:61868695-61868717 GGGGGGACACCTGCCCAGAGTGG - Intronic
1175855429 20:62118463-62118485 AGGGGGACAGGAGGCAGGAGGGG + Intergenic
1178599698 21:33985002-33985024 GGGTGGAGACGGGGCAGGAGGGG + Intergenic
1179540325 21:42079479-42079501 GGAGGGACGTGAGGCATGAGGGG + Intronic
1179613075 21:42564915-42564937 CGGGGGACAGGAGGCATGAGAGG - Intronic
1179822524 21:43944891-43944913 GGGGGGCCACGTGCCCTCAGGGG + Intronic
1181646342 22:24233366-24233388 GGGGGGACACGGAGCCTGTGGGG - Intronic
1185404950 22:50642447-50642469 GCGGGAACACGTGGCCTGAGTGG + Intergenic
955530400 3:59866701-59866723 GGTGGAACACGTGGTATGTGGGG + Intronic
960138414 3:114128832-114128854 CTGGGGACACGTGGCATGTCTGG + Exonic
961715888 3:128857184-128857206 AAGGGGACAAGTGTCATGAGAGG - Intergenic
966006667 3:175022073-175022095 GGTGTGTCACGTGGCAGGAGAGG - Intronic
966877686 3:184332642-184332664 GGGAGGACACCTGGTCTGAGGGG + Intronic
968473423 4:792100-792122 GGGCGGCCACCTGGCATGGGGGG - Intronic
968660598 4:1797292-1797314 AGTGTGACACGGGGCATGAGTGG - Intronic
969486578 4:7475547-7475569 TGGGAGACAAGTGGCAGGAGGGG - Intronic
969843563 4:9901657-9901679 GGGGGGGCATGGGGCTTGAGGGG - Intronic
972878012 4:43388842-43388864 GGGGGTACACCTTGCATAAGAGG - Intergenic
979380922 4:120005746-120005768 GGTGGGTCACATGGCAAGAGAGG - Intergenic
981039221 4:140207440-140207462 GTGGGGACAGGGGGGATGAGTGG - Intergenic
981179620 4:141725228-141725250 GGAGGGACACAGGCCATGAGAGG - Intronic
985089437 4:186348415-186348437 GGGGGGGCAGGTGGGAAGAGGGG - Intergenic
985494669 5:197906-197928 GGGGAGACACGGGGCAGCAGGGG - Exonic
985672419 5:1213432-1213454 GGCGGGACATGTGGGATGGGCGG - Intronic
986332518 5:6727767-6727789 GGAGGGACAGGGGGCATGATGGG - Intronic
988790858 5:34606250-34606272 GGTGAGCCACGTGGCAAGAGAGG + Intergenic
996030454 5:118698979-118699001 GGGGCGACAGGTGGGAGGAGAGG + Intergenic
997653938 5:135541818-135541840 GGGGGGAAACGAGGCAGGAGGGG + Intergenic
998143164 5:139711096-139711118 GGGGCGCCACGCGGCGTGAGGGG - Intergenic
1001859668 5:175042973-175042995 TGGGGGACACTAGGAATGAGAGG - Intergenic
1002055470 5:176595917-176595939 GGGGGGACAAGGGGCTGGAGAGG + Exonic
1003045917 6:2732635-2732657 CGGGGGTCACTTGGCATGATAGG - Intronic
1019370544 7:660666-660688 GTGGGGACCTGTGGCATGGGGGG - Intronic
1019371124 7:662487-662509 GTGGGGACCTGTGGCATGGGGGG - Intronic
1019387811 7:768276-768298 GGGGAGACACGTGGTCTGGGCGG + Intronic
1021297624 7:18927930-18927952 GGGGGGAGACTTGTCATGAATGG + Intronic
1023601667 7:41886975-41886997 ATGGAGACACGTTGCATGAGAGG - Intergenic
1025231334 7:57204952-57204974 GGAGGGACACCTGCCCTGAGAGG - Intergenic
1028659558 7:93253714-93253736 GGGAGGACAGGTGGCATGGAGGG + Intronic
1029303277 7:99600837-99600859 GGAGGGAGACGTGGCAGGCGTGG + Intronic
1029706747 7:102280296-102280318 GGGGGGGCTCCTGGCCTGAGGGG - Intronic
1032479741 7:132236750-132236772 AGGGAGACAGGTGGCAAGAGTGG - Intronic
1033241421 7:139682875-139682897 GAGGGGACAAGGGGCAAGAGGGG - Intronic
1035371965 7:158385875-158385897 GGAGGGACTCGGGGCATGGGAGG - Intronic
1035372146 7:158386417-158386439 GGAGGGACTCGGGGCATGGGAGG - Intronic
1035726074 8:1825069-1825091 GGGGGGACAGGTGGAGTGCGGGG - Intronic
1035726081 8:1825088-1825110 GGGGGGACAGGTGGGGTGCGGGG - Intronic
1035726097 8:1825127-1825149 GGGGGGACAGGTGGGGTGCGGGG - Intronic
1035726106 8:1825146-1825168 GGGGGGACAGGTGGGGTGCGGGG - Intronic
1035726115 8:1825165-1825187 GGGGGGACAGGTGGAGTGCGGGG - Intronic
1035726122 8:1825184-1825206 GGGGGGACAGGTGGGGTGCGGGG - Intronic
1035726131 8:1825203-1825225 GGGGGGACAGGTGGGGTGCGGGG - Intronic
1036387398 8:8294392-8294414 ACGGGGACACGGGGAATGAGGGG - Intergenic
1036615686 8:10385629-10385651 TGGGGGACACATGGCATTTGAGG + Intronic
1047214698 8:122866639-122866661 GGGAAGACAGATGGCATGAGGGG + Intronic
1047233206 8:123015401-123015423 GGGAGGAAATGTGGCTTGAGAGG + Exonic
1048977022 8:139678765-139678787 GGGAGCCCACGTGGCATCAGGGG - Intronic
1056033505 9:82579447-82579469 GGGGTGTCACATGGCAAGAGAGG - Intergenic
1057037013 9:91818493-91818515 TGGGGTCCAGGTGGCATGAGGGG - Intronic
1057887769 9:98844004-98844026 GGGAGGGTACCTGGCATGAGAGG - Intronic
1059246864 9:112856356-112856378 GGGAGGGCACGTGGCATGTAGGG + Intronic
1060884337 9:127139961-127139983 GGGTGGACACATGCCATGAGCGG - Intronic
1061204686 9:129156166-129156188 AGGAGGACACGGGGCATGTGGGG + Intergenic
1061582444 9:131546111-131546133 GGCGGGACACGGGGCGGGAGTGG - Intergenic
1062010096 9:134262215-134262237 GGTGGGATACGTGGCAGGTGGGG - Intergenic
1062522054 9:136961972-136961994 AGGGGGACAGGTGGGCTGAGGGG + Intergenic
1189372529 X:40440263-40440285 GGGGTGTCACGTGGCAAGAGGGG + Intergenic
1199765114 X:150935839-150935861 GGGGAGACAGCTGGCAGGAGGGG + Intergenic