ID: 1081812858

View in Genome Browser
Species Human (GRCh38)
Location 11:45923042-45923064
Sequence CTCCCGTCTGGGGGGACACG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 87}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812858_1081812868 12 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812858_1081812877 26 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812877 11:45923091-45923113 GAGACCCGGGGGCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 317
1081812858_1081812869 13 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812858_1081812871 14 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812858_1081812872 15 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812858_1081812866 4 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812858_1081812875 19 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812858_1081812876 25 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812858_1081812878 27 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812858 Original CRISPR CTCCCGTCTGGGGGGACACG TGG (reversed) Exonic
904237295 1:29123720-29123742 CTCCCGCCTGGGGGAACGGGAGG + Intronic
904702829 1:32368326-32368348 CTCCTGTCTGAGGTGACAGGTGG - Intronic
905240884 1:36580755-36580777 CACCCGGCTGGGGAGACATGTGG + Intergenic
907402031 1:54230172-54230194 CCCCAGTCTGGGTGGGCACGGGG - Intronic
910789482 1:91036206-91036228 CTCCAGTCTGGGGCGACAGAGGG + Intergenic
911187275 1:94916372-94916394 CTCCAGCCTGGGGGGAAACAGGG + Intronic
919170038 1:193942098-193942120 CTCCAGCCTGGGGTGACACTGGG + Intergenic
920022670 1:202967318-202967340 CTCGCGGCTGGGGGGGCAGGAGG + Intergenic
923863912 1:237918919-237918941 CTCCCGTCTGGCTGGACGCCAGG - Intergenic
1065717868 10:28591106-28591128 CTCCTGTCTGGGGGGATCAGGGG - Intronic
1067048632 10:42999810-42999832 CTCCCGTCTGGGTGGCCAGGCGG - Intergenic
1067121121 10:43473137-43473159 CTCCAGTCTGGGGGCACAAGAGG - Intronic
1067270681 10:44789059-44789081 CTCCCTTCTGGTGAGACAGGAGG - Intergenic
1069633782 10:69913315-69913337 GTCCCTTCTGGGGAGACAAGAGG + Intronic
1071527562 10:86366965-86366987 CTCCCGGCTCGGGGGACGCTCGG + Intergenic
1076293057 10:129362259-129362281 CTCACTTCTGGGGGGACCCAAGG + Intergenic
1076369445 10:129942036-129942058 CTCCTGGCTGCGGGGACACAGGG - Intronic
1076588548 10:131567890-131567912 CTCCCATCTGGATGGACACTCGG - Intergenic
1076777124 10:132704123-132704145 CTCCTGTCTGGGGGGACTGGGGG - Intronic
1077316355 11:1921035-1921057 CTCTGGCCTGGGGGGACAGGAGG + Intronic
1081812858 11:45923042-45923064 CTCCCGTCTGGGGGGACACGTGG - Exonic
1081995029 11:47358840-47358862 CTCCTGCCTGGGGAGACAGGTGG - Exonic
1084562240 11:69911533-69911555 CTCCCAAGTGGGGGGACAGGAGG + Intergenic
1089302048 11:117504678-117504700 GTCGCGTCTGGGGGGACAAGAGG + Intronic
1091197549 11:133744861-133744883 CTCCCATCTGGGGGTTCAGGCGG - Intergenic
1112450364 13:99501999-99502021 CTCCCGTCTTGCGGGCCAAGTGG + Intronic
1114621363 14:24098291-24098313 CTCCCGCCTGGTGGGGCCCGTGG + Exonic
1202892977 14_KI270722v1_random:176948-176970 CTCCCTTTTGGGGTGACACTTGG - Intergenic
1123937946 15:25203024-25203046 CTGCCATCTGGGGGTACAGGAGG - Intergenic
1123938207 15:25204154-25204176 CCACCATCTGGGGGGACAGGAGG - Intergenic
1128300881 15:66565687-66565709 CTCCAGTCTGAGGGGGCAGGTGG + Intronic
1129326245 15:74801657-74801679 CCCCAGTCTGAGGGGACATGTGG + Intronic
1129460894 15:75699685-75699707 CTCCCGCCTGGGTGGACTCTGGG - Intronic
1130253462 15:82315225-82315247 CTCCAGTCTGGGTGGACTCAGGG - Intergenic
1132597773 16:761106-761128 CTCCCGTCTGCTGTGACGCGCGG + Exonic
1134639116 16:15814868-15814890 CTCCGTCCTGGGGGGACACCAGG + Intronic
1137552823 16:49452368-49452390 CTGATGTCTGGGGGGAAACGGGG - Intergenic
1139292365 16:65870437-65870459 CTCCTTGCTGGGAGGACACGTGG - Intergenic
1147257897 17:39192946-39192968 CTCCCATCAGGGGGGAGAGGGGG - Intronic
1148344655 17:46895132-46895154 CGCCCGGCTGAGAGGACACGGGG + Intergenic
1148975948 17:51528337-51528359 CTTCCTTCTGGGAGGCCACGGGG - Intergenic
1150620804 17:66806581-66806603 CTCCTCTCTGGGGGGCCTCGTGG - Exonic
1155502198 18:26497877-26497899 CTCCCGTCTCAGGGGACTCCTGG - Intronic
1159511337 18:69401085-69401107 CTCCCGCCGGTGGGGACGCGGGG - Exonic
1160458263 18:79018435-79018457 TGCCACTCTGGGGGGACACGGGG - Intergenic
1161161698 19:2765311-2765333 CTCCGGTCTGTGTGGACACCGGG - Intronic
1161256908 19:3314778-3314800 CTCCCGGCTTGCTGGACACGGGG - Intergenic
1161533447 19:4804127-4804149 CTCCAGGCTTGGGGGACACAAGG + Intergenic
1162348285 19:10134157-10134179 CTGCCCTCTGGGGGTACATGTGG - Intronic
1162501768 19:11058205-11058227 CTCCCGGGTGGGCGGACTCGGGG + Intronic
1165103840 19:33457040-33457062 CTCCCGTGTGGGGCTACACGAGG - Intronic
1167575256 19:50314822-50314844 CCCCCCTGTGGGGGGACTCGGGG - Intronic
1168253404 19:55154200-55154222 CTGCAATCTGGGGGCACACGAGG + Exonic
1168317346 19:55490038-55490060 CTCCCCTCGGGGGGGGCAGGAGG - Intronic
1168677023 19:58286013-58286035 CTCCCGACTGTGAGGACACGTGG - Exonic
929450656 2:42034916-42034938 CTCTCGTCTGGGAGGACAGAAGG + Intergenic
934853917 2:97717440-97717462 CCTCTGGCTGGGGGGACACGAGG + Intronic
934853926 2:97717473-97717495 CCTCTGGCTGGGGGGACACGTGG + Intronic
935430107 2:102966762-102966784 CTCAGGACTGGGGGGACAGGAGG + Intergenic
938453872 2:131445680-131445702 CTCTCCTCTGGGGAGCCACGGGG - Intergenic
946121140 2:217515857-217515879 CTCCTGTCTCAGGGGACAGGAGG + Intronic
1172647966 20:36483375-36483397 CTCCAGGCTGGGGGGAAACCAGG + Intronic
1172944011 20:38674220-38674242 CTCCCGCTCGCGGGGACACGGGG - Intergenic
1174479250 20:50819379-50819401 CTCCACTCTGGGGAGACACAGGG - Intronic
1176869828 21:14075676-14075698 CTCCCTGCTGCGGGCACACGGGG - Intergenic
1179459985 21:41528091-41528113 CTCCATTCTGTGGGGAGACGGGG - Intronic
1179949122 21:44699794-44699816 CTTCGGTCTGGGGGCACACCTGG - Intronic
1181610112 22:24006465-24006487 CTGCCCTCTGGGGGGACTCTGGG - Intergenic
1181831569 22:25564639-25564661 CTCCCCTCGGGGTGGCCACGAGG - Intergenic
1182096748 22:27630822-27630844 CTCCAGTTGGGGGGGACACATGG - Intergenic
1184935699 22:47718743-47718765 GTTCCATCTGGAGGGACACGGGG - Intergenic
953128105 3:40111083-40111105 CTGCCTTCTGGGGGGACCCTGGG - Intronic
954428433 3:50456072-50456094 CTCCCTTCTGGGGTGTCACAAGG - Intronic
985706953 5:1406872-1406894 CTCCCGTCAGTGGAGTCACGTGG + Intronic
1001999415 5:176189388-176189410 CTCCTGTCTGGGGGCCCAGGAGG - Intergenic
1006407820 6:33855462-33855484 CTGCCGTCAGGCAGGACACGTGG - Intergenic
1007243324 6:40442564-40442586 CCCCAGTCTGAGGGGAGACGCGG - Intronic
1012749601 6:103140666-103140688 CTACTGTCTGTGGGGACAGGAGG + Intergenic
1017164178 6:151391656-151391678 CTCCCGCCGGGGGGGAGAGGCGG + Intergenic
1019297276 7:284786-284808 CTCCCTTCTGGGGCGAGCCGAGG + Intergenic
1019393506 7:803488-803510 CTCCAGCCTGGGGTGACACAGGG - Intergenic
1019592855 7:1844380-1844402 CTCCAGGCTGGGGGGAGACCTGG + Intronic
1025282793 7:57640453-57640475 CAGCTGTCTGGGGGGACACTGGG + Intergenic
1033032777 7:137844023-137844045 CTCCCTTCTGGGGGCACCTGAGG - Intronic
1036706476 8:11050766-11050788 CATCCGTCTGTGGGGACATGAGG - Intronic
1037758678 8:21727683-21727705 CTGCCGTCTGCGGGCAGACGAGG - Intronic
1048427553 8:134336827-134336849 ATCCCATCTGGGGAGACACAAGG - Intergenic
1049880625 8:145059829-145059851 CTCCCGTCTGGCTGGACGCTGGG - Intergenic
1059388742 9:113985514-113985536 CTCCCCTCTGGGGGGCCAGGGGG + Intronic
1059426719 9:114225805-114225827 CTCCCGGCTGCAGGGACCCGGGG - Intronic
1060105298 9:120869324-120869346 CGCCTTTCTGGGGGGAGACGAGG + Exonic
1060846718 9:126843083-126843105 CTCCAGCCTGGGGGGACAGAGGG - Intergenic
1190873863 X:54446120-54446142 CTCGGGTCTGGGGGGATTCGGGG + Exonic
1200149182 X:153943073-153943095 CTTCCGTCTGGGGGTGCAGGAGG + Exonic
1200279090 X:154761770-154761792 CTCCCTTCTCGTGGGACCCGTGG - Intergenic