ID: 1081812860

View in Genome Browser
Species Human (GRCh38)
Location 11:45923049-45923071
Sequence TCCCCCCAGACGGGAGGCTG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 874
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 843}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812853_1081812860 -2 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812848_1081812860 13 Left 1081812848 11:45923013-45923035 CCCCGGGATGCTTCCCCGGCCCG 0: 1
1: 0
2: 1
3: 8
4: 84
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812854_1081812860 -6 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812850_1081812860 11 Left 1081812850 11:45923015-45923037 CCGGGATGCTTCCCCGGCCCGCT 0: 1
1: 0
2: 1
3: 8
4: 125
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812851_1081812860 0 Left 1081812851 11:45923026-45923048 CCCCGGCCCGCTCATGCCACGTG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812852_1081812860 -1 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812855_1081812860 -7 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843
1081812849_1081812860 12 Left 1081812849 11:45923014-45923036 CCCGGGATGCTTCCCCGGCCCGC 0: 1
1: 0
2: 0
3: 10
4: 154
Right 1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG 0: 1
1: 0
2: 1
3: 29
4: 843

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812860 Original CRISPR TCCCCCCAGACGGGAGGCTG CGG Exonic
900217906 1:1491413-1491435 CCCAGCCACACGGGAGGCTGAGG + Intronic
900250048 1:1664065-1664087 TCCAGCCACATGGGAGGCTGAGG + Exonic
900255262 1:1694569-1694591 TCCAACCACTCGGGAGGCTGAGG + Intronic
900261081 1:1729975-1729997 TCCAGCCACATGGGAGGCTGAGG + Intronic
900474012 1:2867973-2867995 TCCCCCTGGCCAGGAGGCTGGGG - Intergenic
900496509 1:2978389-2978411 CCCCACCAGAGGGGAGGGTGGGG + Intergenic
901407042 1:9056299-9056321 CCCCCCTACTCGGGAGGCTGAGG - Intronic
901534256 1:9872194-9872216 TGCTCCCAGAAGGGAGACTGTGG - Intronic
901629926 1:10643048-10643070 TGCCCACAGAGGGCAGGCTGAGG + Intronic
901670113 1:10851152-10851174 TCCCACCACATGGGAGGCCGAGG - Intergenic
901887771 1:12235457-12235479 TCCCACTACTCGGGAGGCTGAGG + Intronic
902675043 1:18002865-18002887 TCCCTGTAGTCGGGAGGCTGAGG + Intergenic
902937810 1:19777187-19777209 TCCTCCCTGACGGGAGACTTGGG + Intronic
903039238 1:20516045-20516067 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
903091195 1:20919322-20919344 TCCAGCTATACGGGAGGCTGAGG - Intronic
903146428 1:21375689-21375711 TCCAGCCAGTCGGGAGGCTGAGG + Intergenic
903433364 1:23326667-23326689 TCCAGCCACTCGGGAGGCTGAGG + Intronic
903511858 1:23881772-23881794 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
903527263 1:24000782-24000804 TCCACCCATTTGGGAGGCTGAGG + Intergenic
903608870 1:24595435-24595457 ATCCCCCAGAGGGGTGGCTGTGG - Exonic
903629737 1:24758570-24758592 CCCAGCCAGTCGGGAGGCTGAGG - Intronic
903997261 1:27315192-27315214 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
904185321 1:28699543-28699565 TCTCACTACACGGGAGGCTGAGG - Intronic
904324852 1:29721782-29721804 TGCCCCATGACTGGAGGCTGGGG + Intergenic
905463295 1:38135072-38135094 TCCCTCAAGTAGGGAGGCTGAGG + Intergenic
905476672 1:38233552-38233574 CCCACCTAGTCGGGAGGCTGAGG + Intergenic
905870448 1:41400991-41401013 TCCATCTACACGGGAGGCTGAGG - Intergenic
905922883 1:41730800-41730822 ACCCCACAGGTGGGAGGCTGGGG + Intronic
906233166 1:44183281-44183303 TCCAGCCAGTTGGGAGGCTGAGG - Intergenic
906304711 1:44709554-44709576 CCCACCTACACGGGAGGCTGAGG + Intronic
906377812 1:45310194-45310216 CCCCGCCACTCGGGAGGCTGAGG + Intergenic
907377565 1:54056439-54056461 CCCCACCACTCGGGAGGCTGAGG - Intronic
907526365 1:55056350-55056372 CCCCGCCATGCGGGAGGCTGGGG + Intronic
908128247 1:61050834-61050856 CCCCCCCGGGCGGGAGGCCGCGG + Intronic
908202018 1:61807290-61807312 TCCAGCCAGTCAGGAGGCTGAGG - Intronic
908524829 1:64977544-64977566 CCCACCTAGTCGGGAGGCTGAGG - Intergenic
909527129 1:76637942-76637964 TCCAGCTAGACGGGAGGCTGAGG - Intergenic
911631989 1:100193717-100193739 TCCACCTACTCGGGAGGCTGAGG - Exonic
911719216 1:101172022-101172044 TCCACCTACTCGGGAGGCTGAGG + Intergenic
912281698 1:108322560-108322582 TCCCAGCTCACGGGAGGCTGAGG - Intergenic
912328817 1:108797526-108797548 TAATCCCAGATGGGAGGCTGAGG - Intronic
912799873 1:112714199-112714221 TCCTCCCACACAGGAGGCTAAGG + Intronic
913003279 1:114603254-114603276 TCCCACTACTCGGGAGGCTGAGG - Intronic
913121246 1:115742902-115742924 TCCCACTACTCGGGAGGCTGAGG - Intronic
914739342 1:150450734-150450756 TCCACCTATTCGGGAGGCTGAGG - Intronic
916279414 1:163032639-163032661 CCCAGCCAGTCGGGAGGCTGAGG - Intergenic
916959770 1:169877269-169877291 TCCCCCTACACCGGAGACTGAGG - Intronic
918030571 1:180804225-180804247 TCCCAGCACTCGGGAGGCTGAGG - Intronic
919526945 1:198665203-198665225 CCCCCCTACTCGGGAGGCTGAGG - Intronic
920170980 1:204072515-204072537 ACCCCCTACTCGGGAGGCTGAGG - Intergenic
920287422 1:204890683-204890705 TCCAGCCACTCGGGAGGCTGAGG - Intronic
921729006 1:218555767-218555789 TCCCAGCACTCGGGAGGCTGAGG - Intergenic
922472506 1:225885293-225885315 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
922645654 1:227283939-227283961 TCCCAGCACTCGGGAGGCTGGGG + Intronic
922821089 1:228486584-228486606 TCCCCCCAGCCAGGAGACAGCGG + Intergenic
923615426 1:235533339-235533361 TCCACCTACTCGGGAGGCTGAGG + Intergenic
923789852 1:237102737-237102759 TCCCGCTACTCGGGAGGCTGAGG + Intronic
924233116 1:241978749-241978771 TCCCCCTACCTGGGAGGCTGAGG + Intergenic
924387059 1:243508779-243508801 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1062841097 10:672464-672486 CCACCCCAGAGGCGAGGCTGGGG + Intronic
1063452674 10:6161746-6161768 CCCACCCACTCGGGAGGCTGAGG - Intronic
1063805136 10:9630465-9630487 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1064050066 10:12052350-12052372 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1064101794 10:12470630-12470652 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1064182784 10:13133922-13133944 TCCAGCCACTCGGGAGGCTGTGG - Intronic
1064281721 10:13957367-13957389 CCCAGCTAGACGGGAGGCTGAGG - Intronic
1064374522 10:14783578-14783600 TCCACCTACATGGGAGGCTGAGG - Intergenic
1064638376 10:17391375-17391397 TCCCACCACTCGGGAGGCTGAGG - Intronic
1064727727 10:18298251-18298273 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1064947493 10:20807072-20807094 TCCCCGCACTTGGGAGGCTGAGG + Intronic
1065031899 10:21594716-21594738 TACCTTCAGTCGGGAGGCTGAGG + Intronic
1065260300 10:23916854-23916876 TCCAGCTACACGGGAGGCTGAGG + Intronic
1065459735 10:25946760-25946782 TCCCGCTACACGGGAGGCTGAGG + Intronic
1065725467 10:28664402-28664424 GCCCCTTAGTCGGGAGGCTGAGG - Intergenic
1065768220 10:29052134-29052156 TCCCGCCACTTGGGAGGCTGAGG + Intergenic
1065960069 10:30726942-30726964 GCCGCGCAGACGGAAGGCTGTGG + Intergenic
1066568076 10:36741507-36741529 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1066976348 10:42371364-42371386 CCCAGCCACACGGGAGGCTGAGG - Intergenic
1067121773 10:43478435-43478457 TCCCGCTACTCGGGAGGCTGAGG + Intronic
1067458907 10:46443096-46443118 TCCCAGCACTCGGGAGGCTGAGG - Intergenic
1067480350 10:46592683-46592705 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1067531602 10:47078168-47078190 TCCCCAAAGATGGGAGGGTGTGG + Intergenic
1067614387 10:47749116-47749138 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1067628289 10:47941536-47941558 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1067790322 10:49282977-49282999 TCCCGCCATCCGGGAGGGTGGGG + Intergenic
1068673231 10:59744347-59744369 ACCTCCCAGACGGGTGGCGGCGG - Intergenic
1069352077 10:67539598-67539620 TCTCCCAAAAAGGGAGGCTGTGG - Exonic
1069376544 10:67798879-67798901 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1069383495 10:67863695-67863717 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1069517874 10:69093749-69093771 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
1070093770 10:73315677-73315699 TCCCACCACTTGGGAGGCTGAGG - Intronic
1070125994 10:73622437-73622459 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1070916855 10:80160658-80160680 TCCCCTCAGGAGGGAGACTGTGG - Intronic
1071629793 10:87209092-87209114 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1072865299 10:99053842-99053864 TCCCAGCATTCGGGAGGCTGAGG - Intronic
1073219827 10:101861931-101861953 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1073324505 10:102634506-102634528 TCCCCGGAGACTGGGGGCTGGGG + Intergenic
1073407039 10:103307319-103307341 ACCAGCCACACGGGAGGCTGAGG + Intronic
1073570007 10:104572766-104572788 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1074160730 10:110834423-110834445 CCACCCCAGAAGGGAGGGTGAGG + Intronic
1074200949 10:111234689-111234711 TCCCTCAAGTCGGCAGGCTGTGG + Intergenic
1074395763 10:113096831-113096853 TCCCTCCAGAGGGGAGGGTGGGG + Intronic
1074824022 10:117201907-117201929 CCCCACCAGAAGGGAAGCTGGGG - Intronic
1074948403 10:118303694-118303716 TCCACCTACTCGGGAGGCTGAGG + Exonic
1076004990 10:126941637-126941659 TCCCGCTACTCGGGAGGCTGAGG + Intronic
1076005047 10:126942138-126942160 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1076481462 10:130787839-130787861 TCCCCCCTGAAGGCAGGCTCTGG + Intergenic
1076645510 10:131951702-131951724 TCCCACCACTCAGGAGGCTGAGG + Intronic
1076693735 10:132237084-132237106 TCTCAACAGTCGGGAGGCTGTGG - Intronic
1076921095 10:133455149-133455171 TCCCGCTACATGGGAGGCTGAGG + Intergenic
1077098606 11:810675-810697 TCCCCCTACTTGGGAGGCTGAGG + Intronic
1077422767 11:2460725-2460747 ACCCCCCATCCGGGTGGCTGTGG + Intronic
1077441632 11:2571730-2571752 GCCCCCCAGAAGGCAGTCTGGGG + Intronic
1078056498 11:8013376-8013398 TCCACCTACTCGGGAGGCTGAGG + Intergenic
1078782198 11:14449778-14449800 TCCCACTACTCGGGAGGCTGAGG - Intronic
1079033093 11:17000197-17000219 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1079442457 11:20528750-20528772 CCCACCTACACGGGAGGCTGAGG + Intergenic
1079604318 11:22345425-22345447 TCCCACTACTCGGGAGGCTGAGG - Intronic
1079929102 11:26535696-26535718 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1079989596 11:27232878-27232900 TCCCACCATTCTGGAGGCTGAGG + Intergenic
1081481846 11:43496875-43496897 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1081698589 11:45137045-45137067 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1081812860 11:45923049-45923071 TCCCCCCAGACGGGAGGCTGCGG + Exonic
1081900347 11:46622231-46622253 CCCAGCTAGACGGGAGGCTGAGG - Intronic
1081923631 11:46803382-46803404 CCCAGCCAGTCGGGAGGCTGAGG - Intronic
1081946157 11:46996417-46996439 CCCAGCTAGACGGGAGGCTGAGG - Intronic
1083017576 11:59471563-59471585 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1083046420 11:59740081-59740103 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1083180070 11:60979580-60979602 TCCCCTTACTCGGGAGGCTGAGG - Intronic
1083187768 11:61027343-61027365 TCACCCCAGAGGGGAGGCCATGG - Intergenic
1083233403 11:61337259-61337281 TCCCACTAGTCGGAAGGCTGAGG - Intronic
1083254325 11:61486912-61486934 AACCACCAGAAGGGAGGCTGAGG - Intronic
1083574583 11:63780746-63780768 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1083893524 11:65608731-65608753 TCCCACTACTCGGGAGGCTGGGG - Intronic
1084469369 11:69347554-69347576 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1084590705 11:70088391-70088413 CCCCCCTACTCGGGAGGCTGAGG + Intronic
1084923445 11:72492149-72492171 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1085188544 11:74597574-74597596 TCCAGCTAGTCGGGAGGCTGAGG - Intronic
1085314474 11:75536042-75536064 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1085436553 11:76509374-76509396 TCCCGCTACTCGGGAGGCTGAGG + Intronic
1086190302 11:84071205-84071227 TCCAACCACATGGGAGGCTGAGG - Intronic
1086460511 11:87001199-87001221 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1086989385 11:93286727-93286749 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1087448887 11:98292168-98292190 TCCCAGCTGTCGGGAGGCTGAGG + Intergenic
1088487295 11:110352959-110352981 TCCAGCCACATGGGAGGCTGAGG + Intergenic
1088658346 11:112023727-112023749 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1088874365 11:113921501-113921523 TAGTCCCAGATGGGAGGCTGAGG + Intronic
1089092432 11:115889032-115889054 TTCCCACAGACAGGAGGCTGAGG + Intergenic
1089130294 11:116207098-116207120 TCACCCCAGCCCAGAGGCTGAGG - Intergenic
1089443221 11:118532799-118532821 TCTCCTCAGAGGGGATGCTGAGG - Intronic
1089700936 11:120243347-120243369 TCCCCACAGGCTGCAGGCTGAGG - Intronic
1089843550 11:121440256-121440278 TCCAGCTACACGGGAGGCTGAGG + Intergenic
1090449322 11:126792029-126792051 CTCCCCCAAAAGGGAGGCTGGGG - Intronic
1090761736 11:129843053-129843075 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1090862577 11:130666956-130666978 TTCCTCCAGATGGCAGGCTGCGG - Intergenic
1091488849 12:915828-915850 CCCCCCTACTCGGGAGGCTGAGG - Intronic
1091843796 12:3639138-3639160 TCCCCCTAGACAAGAGGCTTTGG + Intronic
1092226163 12:6749597-6749619 TCCAGCTACACGGGAGGCTGAGG + Intronic
1092363514 12:7858014-7858036 TCCCACCACTTGGGAGGCTGAGG + Intronic
1092602205 12:10079568-10079590 TCCCAGCAGTTGGGAGGCTGAGG + Intronic
1092614183 12:10201310-10201332 CCCCACCACTCGGGAGGCTGAGG - Intergenic
1093543920 12:20322150-20322172 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1093555256 12:20465524-20465546 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1093867390 12:24244806-24244828 TCCCACCACTTGGGAGGCTGAGG - Intergenic
1094279840 12:28723896-28723918 TAATCCCAGTCGGGAGGCTGAGG + Intergenic
1094599404 12:31895253-31895275 TCCCAGCATTCGGGAGGCTGAGG - Intergenic
1094615841 12:32035479-32035501 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1095051886 12:37561912-37561934 TCCACCTACTCGGGAGGCTGAGG + Intergenic
1095092168 12:38117651-38117673 TCTCATCAGAGGGGAGGCTGGGG - Intergenic
1095243767 12:39893413-39893435 CCCAGCCAGTCGGGAGGCTGAGG - Intronic
1096297092 12:50393040-50393062 CCCACCCACTCGGGAGGCTGAGG - Intronic
1096663677 12:53147024-53147046 TCCCAGCACATGGGAGGCTGAGG - Intergenic
1097283621 12:57861212-57861234 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1098247310 12:68533778-68533800 CCCACCCACTCGGGAGGCTGAGG - Intergenic
1098364960 12:69692876-69692898 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1100180700 12:92083020-92083042 TCCCTCTACTCGGGAGGCTGAGG - Intronic
1100977162 12:100134499-100134521 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1101127031 12:101646521-101646543 CCCGGCCACACGGGAGGCTGAGG + Intronic
1101166861 12:102046409-102046431 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1101602468 12:106222582-106222604 TCCACCTACTCGGGAGGCTGAGG + Intergenic
1101949439 12:109163037-109163059 CCCCCCTACATGGGAGGCTGAGG - Intronic
1101999314 12:109546823-109546845 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1102049669 12:109853570-109853592 TCCCACTACTCGGGAGGCTGAGG + Intronic
1102054409 12:109885596-109885618 TCCAGCTATACGGGAGGCTGAGG - Intergenic
1102066708 12:109982754-109982776 TCCCGCTACCCGGGAGGCTGAGG - Intronic
1102152588 12:110699010-110699032 CCCAGCCAGTCGGGAGGCTGAGG + Intronic
1103078898 12:118007664-118007686 TCCAACTACACGGGAGGCTGAGG + Intergenic
1103142097 12:118557429-118557451 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1103655736 12:122468872-122468894 CCCCGCTAGTCGGGAGGCTGAGG + Intergenic
1103750259 12:123153647-123153669 CCCACCTACACGGGAGGCTGAGG + Intronic
1103758690 12:123232541-123232563 TCCGCCTTGACGGGAGGCTTGGG + Intronic
1103797751 12:123516507-123516529 TGCCCCCAGAGGGGAGGGAGTGG - Intronic
1103939267 12:124493047-124493069 CCCCTCCAGGCAGGAGGCTGAGG - Intronic
1105332779 13:19433385-19433407 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1105659605 13:22479402-22479424 TCCAGCTACACGGGAGGCTGAGG - Intergenic
1105902173 13:24764572-24764594 ACCCTCCAGCCGGGAGGATGGGG + Intronic
1106199127 13:27521478-27521500 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1106296895 13:28422668-28422690 TCCCCACAAACGGGATGGTGGGG - Intronic
1106877568 13:34090435-34090457 CCCCCCTACTCGGGAGGCTGAGG + Intergenic
1107355378 13:39560628-39560650 TCCAGCTACACGGGAGGCTGAGG - Intronic
1107689756 13:42941502-42941524 TCCCCCTACGTGGGAGGCTGAGG + Intronic
1107855215 13:44608396-44608418 TCCAGCCACCCGGGAGGCTGAGG + Intergenic
1108610148 13:52077425-52077447 TCTCTCAAGACAGGAGGCTGGGG - Intronic
1109747219 13:66640989-66641011 TCCCACTACTCGGGAGGCTGAGG - Intronic
1110284959 13:73739116-73739138 TCCCACTACTCGGGAGGCTGAGG + Intronic
1110629413 13:77690473-77690495 CCCAGCCAGTCGGGAGGCTGAGG - Intergenic
1111212995 13:85105070-85105092 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1111314895 13:86542339-86542361 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1111352571 13:87050622-87050644 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1111500707 13:89117368-89117390 TCCCAGCATTCGGGAGGCTGAGG - Intergenic
1113335421 13:109372244-109372266 TCACTCCAGACTGGAGACTGGGG - Intergenic
1113653383 13:112053806-112053828 TCCACCCAGACGGCCGGCTGTGG + Intergenic
1114591844 14:23872849-23872871 TCCACCTACATGGGAGGCTGAGG + Intergenic
1115545134 14:34459018-34459040 TCCCACTAGTCGGGAGGCTGAGG - Intronic
1115756274 14:36528493-36528515 TCCCACCATTCAGGAGGCTGGGG - Intergenic
1115854577 14:37616990-37617012 TCCAGCTAGACAGGAGGCTGAGG - Intronic
1116117748 14:40678846-40678868 TCCCAGCAGTTGGGAGGCTGAGG + Intergenic
1116144063 14:41041033-41041055 TCCAGCTACACGGGAGGCTGAGG - Intergenic
1117141634 14:52795814-52795836 TCCCAGCAGTTGGGAGGCTGAGG - Intergenic
1118368394 14:65115115-65115137 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1118393684 14:65317674-65317696 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1119641895 14:76321769-76321791 TCTTCCCATTCGGGAGGCTGAGG + Intronic
1119728949 14:76938938-76938960 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1119951735 14:78752298-78752320 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1120027607 14:79604001-79604023 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1120144544 14:80965226-80965248 TCCACCCAGAAGGAATGCTGAGG - Intronic
1121579171 14:95013814-95013836 TCCCACCAGATGGGAGGCAGGGG + Intergenic
1121656107 14:95597045-95597067 CCCAGCCAGTCGGGAGGCTGAGG - Intergenic
1122051994 14:99066884-99066906 AGCCCCCAGAGTGGAGGCTGAGG - Intergenic
1122053106 14:99073612-99073634 TTCCCACAGCAGGGAGGCTGGGG + Intergenic
1122467409 14:101943469-101943491 TCCCTCCACACAAGAGGCTGAGG - Intergenic
1122638746 14:103144288-103144310 GCCACCCAGAAGGGATGCTGAGG + Intergenic
1122871583 14:104641235-104641257 TCCCCTGAGAAGGCAGGCTGGGG + Intergenic
1122948307 14:105024642-105024664 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1122996306 14:105266925-105266947 TCCAGCTACACGGGAGGCTGAGG + Intronic
1123666080 15:22610278-22610300 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1124318589 15:28693874-28693896 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1124319903 15:28704691-28704713 TCCACCTACTCGGGAGGCTGAGG - Intronic
1124482608 15:30090739-30090761 TCCACCTACTCGGGAGGCTGAGG + Intronic
1124489066 15:30142831-30142853 TCCACCTACTCGGGAGGCTGAGG + Intronic
1124520969 15:30406479-30406501 TCCACCTACTCGGGAGGCTGAGG - Intronic
1124537693 15:30559740-30559762 TCCACCTACTCGGGAGGCTGAGG + Intronic
1124544149 15:30611801-30611823 TCCACCTACTCGGGAGGCTGAGG + Intronic
1124561936 15:30782304-30782326 CCCACCCACTCGGGAGGCTGAGG - Intergenic
1124564854 15:30803572-30803594 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1124687472 15:31794712-31794734 ATCCCCCAGACGGTGGGCTGGGG - Intronic
1124754464 15:32395493-32395515 TCCACCTACTCGGGAGGCTGAGG - Intronic
1124760963 15:32447846-32447868 TCCACCTACTCGGGAGGCTGAGG - Intronic
1124777671 15:32601217-32601239 TCCACCTACTCGGGAGGCTGAGG + Intronic
1125014810 15:34921924-34921946 TCCACCTATTCGGGAGGCTGAGG - Intronic
1125110415 15:36025781-36025803 TCTCACCAGAAGGGAGGCTGGGG + Intergenic
1125180632 15:36878471-36878493 TCCCCCGAGACAGGAAGCTGGGG - Intergenic
1125303424 15:38282389-38282411 TCCCACCACTTGGGAGGCTGAGG + Intronic
1125580371 15:40781030-40781052 TCCCCCTACTTGGGAGGCTGAGG + Intronic
1125580510 15:40782106-40782128 TCCCCCTACTCAGGAGGCTGAGG + Intronic
1125640423 15:41225770-41225792 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1125644638 15:41261740-41261762 TCCCACCACTTGGGAGGCTGAGG + Intronic
1125649824 15:41307421-41307443 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1126291783 15:47089154-47089176 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1126381845 15:48056413-48056435 TCCACCTACATGGGAGGCTGAGG + Intergenic
1126618171 15:50607937-50607959 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1126708528 15:51430280-51430302 TAACCCCAGCCAGGAGGCTGAGG - Intergenic
1127767035 15:62196269-62196291 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1127827016 15:62713151-62713173 TCCACCTACTCGGGAGGCTGAGG + Intronic
1127917909 15:63470618-63470640 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1128030722 15:64477742-64477764 CCCAGCCAGTCGGGAGGCTGAGG - Intronic
1128066686 15:64769306-64769328 TCCCCCTACTTGGGAGGCTGAGG + Intronic
1128213343 15:65917218-65917240 TCCCCTGAGAGGGGAGGCTCGGG - Intronic
1128263308 15:66247917-66247939 TCCAGCCACTCGGGAGGCTGGGG + Intronic
1128634512 15:69294432-69294454 TCCCAGCACATGGGAGGCTGAGG + Intergenic
1128640662 15:69334065-69334087 TCTCACCAGACTGGAGGCAGTGG + Intronic
1129142985 15:73618718-73618740 TCCCACTACTCGGGAGGCTGGGG + Intronic
1129184684 15:73898746-73898768 TCCAGCCAGTTGGGAGGCTGAGG + Intergenic
1129441651 15:75585331-75585353 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1129518267 15:76170244-76170266 TCCCGCCACACGGGTGGGTGTGG + Intronic
1129594636 15:76952734-76952756 CCCACCTAGTCGGGAGGCTGAGG - Intronic
1129710115 15:77816599-77816621 CCCTCCCAGTCAGGAGGCTGGGG + Intronic
1130639140 15:85654706-85654728 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1130682101 15:86005973-86005995 CCCACCTACACGGGAGGCTGAGG - Intergenic
1130709619 15:86266783-86266805 TCCCGCTACTCGGGAGGCTGAGG + Intronic
1131113108 15:89777308-89777330 TCTCTGCAGACTGGAGGCTGGGG - Intronic
1131519036 15:93099574-93099596 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1132410679 15:101576166-101576188 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1132424765 15:101706074-101706096 TCCAGCTACACGGGAGGCTGAGG - Intronic
1132459034 16:40935-40957 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1132567495 16:630170-630192 GCCCCGCCGACGGGGGGCTGGGG + Intronic
1132675873 16:1121045-1121067 GCCCACAAGCCGGGAGGCTGAGG - Intergenic
1132715359 16:1287443-1287465 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1132742718 16:1423393-1423415 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1132767925 16:1544131-1544153 CCCACCTACACGGGAGGCTGAGG - Intronic
1132794123 16:1710355-1710377 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1132800016 16:1747387-1747409 TCCTCACAGCCCGGAGGCTGGGG + Intronic
1132882404 16:2168211-2168233 TTCCCCCAGGAGGGAGGATGGGG - Intronic
1132913322 16:2327226-2327248 TCCACCTACTCGGGAGGCTGAGG - Intronic
1133204235 16:4223491-4223513 TCCCACTACTCGGGAGGCTGAGG - Intronic
1133318145 16:4896753-4896775 TAGTCCCAGATGGGAGGCTGAGG - Intronic
1133437863 16:5795417-5795439 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1133746040 16:8687408-8687430 CCCAGCCACACGGGAGGCTGAGG + Intronic
1134244948 16:12532992-12533014 TCCCCACAGACGAGGGGCTCAGG - Intronic
1134299394 16:12976201-12976223 TCCAGCTAGTCGGGAGGCTGAGG - Intronic
1134595591 16:15493234-15493256 GCCCCCTACTCGGGAGGCTGAGG + Intronic
1134894413 16:17871735-17871757 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1134979578 16:18596082-18596104 TCCCGCCACTCTGGAGGCTGAGG - Intergenic
1135119272 16:19751360-19751382 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1135530348 16:23247686-23247708 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1135695804 16:24585311-24585333 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1135987254 16:27193028-27193050 ATCCCCTACACGGGAGGCTGAGG + Intergenic
1136109904 16:28058177-28058199 TGCACCCAGGCGGGAGGCTCCGG - Intronic
1136113680 16:28081076-28081098 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1136163130 16:28434388-28434410 TCCCGCCACTCAGGAGGCTGAGG - Intergenic
1136199835 16:28680600-28680622 TCCCGCCACTCAGGAGGCTGAGG + Intergenic
1136216183 16:28794775-28794797 TCCCGCCACTCAGGAGGCTGAGG + Intergenic
1137602116 16:49763392-49763414 TAGTCCCAGTCGGGAGGCTGAGG - Intronic
1139407358 16:66729690-66729712 TCCCAGCAGTTGGGAGGCTGAGG - Intronic
1140439987 16:74980467-74980489 TCCACCTACTCGGGAGGCTGAGG - Intronic
1140499178 16:75418420-75418442 CCCACCTACACGGGAGGCTGAGG - Intronic
1141160760 16:81627923-81627945 GCCCACCTGACGGGAAGCTGAGG + Intronic
1141529495 16:84636439-84636461 CCCACCTACACGGGAGGCTGAGG - Intergenic
1141664092 16:85456994-85457016 AGCCCCCAGAAAGGAGGCTGCGG - Intergenic
1141990893 16:87608919-87608941 TCCCACCACTCAGGAGGCTGAGG + Intronic
1142054941 16:87987879-87987901 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1142101454 16:88273918-88273940 TCCAGCTACACGGGAGGCTGAGG - Intergenic
1142103892 16:88291813-88291835 TCTCCCCAGAAGGGAGACTGAGG - Intergenic
1142133454 16:88441272-88441294 TCACACCAGACGGGTGCCTGGGG - Intergenic
1142609341 17:1100008-1100030 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1143096283 17:4480225-4480247 TCCCTCCAGACAGGAGACTTGGG + Intronic
1143362735 17:6384715-6384737 TCCCCACAGAGGAGAGGATGTGG - Intergenic
1143560123 17:7688772-7688794 TCCCCCCTTTCGGGAGGCGGTGG - Exonic
1143564335 17:7712339-7712361 TCCATCCACGCGGGAGGCTGAGG - Intergenic
1143716472 17:8775026-8775048 CCCACCTAGTCGGGAGGCTGAGG - Intergenic
1144390405 17:14788367-14788389 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1144576020 17:16429978-16430000 CCCAGCCATACGGGAGGCTGAGG - Intronic
1144589897 17:16515114-16515136 TCCAGCCATTCGGGAGGCTGAGG - Intergenic
1144607646 17:16681741-16681763 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1144932634 17:18872155-18872177 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1145197190 17:20904371-20904393 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1146319278 17:31833875-31833897 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1146529364 17:33595108-33595130 TCCACCTACATGGGAGGCTGAGG + Intronic
1146905290 17:36614158-36614180 TCCCCCCAGAGAGCAGGGTGAGG - Intergenic
1146996537 17:37325688-37325710 TCCAGCCAGTCGAGAGGCTGAGG - Intronic
1147039348 17:37706072-37706094 TCCATCCACTCGGGAGGCTGAGG - Intronic
1147150837 17:38512715-38512737 GCCCCGCAGACAGGAGGCTTGGG + Intergenic
1147297935 17:39499623-39499645 TCCAGCTACACGGGAGGCTGAGG - Intronic
1147421258 17:40323156-40323178 TCCCCACAGACAGAAGTCTGGGG - Intronic
1148280423 17:46342750-46342772 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1148302651 17:46560685-46560707 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1148585065 17:48771957-48771979 TCCACCTACTCGGGAGGCTGAGG + Intronic
1148835473 17:50463641-50463663 TCCCTCCAGCCAGGAGACTGAGG + Intronic
1148866255 17:50630348-50630370 GCCCACCAGGTGGGAGGCTGGGG - Intergenic
1148938805 17:51188873-51188895 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1149262812 17:54898009-54898031 TCCAGCTACACGGGAGGCTGAGG - Intergenic
1149480293 17:56998060-56998082 TCCCACCACTTGGGAGGCTGAGG + Intronic
1149766693 17:59284731-59284753 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1149935520 17:60802755-60802777 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1150376452 17:64685398-64685420 TAATCCCAGGCGGGAGGCTGAGG + Intergenic
1150399578 17:64846627-64846649 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1150643824 17:66965910-66965932 GCCCCTCAGCAGGGAGGCTGCGG + Intronic
1150763662 17:67986426-67986448 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1151105387 17:71607650-71607672 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1151525036 17:74659337-74659359 TCGCCTCAGCCGGGAGGCAGGGG - Intergenic
1151631503 17:75314192-75314214 TCCCCTCTAACTGGAGGCTGAGG - Intergenic
1151672242 17:75577548-75577570 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1151702241 17:75749737-75749759 TTCTCCCAGTTGGGAGGCTGAGG - Intronic
1151775369 17:76197682-76197704 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1151798673 17:76364287-76364309 TCCCACTACTCGGGAGGCTGAGG - Intronic
1151840793 17:76615912-76615934 TCCAGCTACACGGGAGGCTGAGG + Intergenic
1151845049 17:76647841-76647863 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1152288183 17:79424364-79424386 TGCCCCCAGAAGTGAAGCTGGGG + Intronic
1152367286 17:79863697-79863719 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
1152814444 17:82399085-82399107 TCCCAGCACCCGGGAGGCTGAGG - Intronic
1153249498 18:3107231-3107253 CCCACCCACTCGGGAGGCTGAGG - Intronic
1153347966 18:4049109-4049131 TCCAGCTAGTCGGGAGGCTGTGG + Intronic
1153689094 18:7573703-7573725 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1153861275 18:9210603-9210625 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1153898402 18:9591229-9591251 TCCCACCACTCGAGAGGCTGAGG + Intronic
1154218625 18:12433539-12433561 TCCCAGCTGTCGGGAGGCTGAGG - Intergenic
1154373841 18:13792264-13792286 CCCACCCACTCGGGAGGCTGAGG - Intergenic
1154970920 18:21408676-21408698 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
1155193952 18:23455506-23455528 TCCCACTACTCGGGAGGCTGAGG - Intronic
1155319964 18:24609356-24609378 TGTCCCCAGAGTGGAGGCTGAGG - Intergenic
1155527474 18:26731674-26731696 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1155720245 18:29002256-29002278 CCCAGCCAGTCGGGAGGCTGAGG + Intergenic
1156438337 18:37157691-37157713 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1156805914 18:41181514-41181536 GCCACCCAGAAGGAAGGCTGAGG + Intergenic
1158593004 18:58793011-58793033 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1158819877 18:61147126-61147148 CCCAGCCAGTCGGGAGGCTGAGG + Intergenic
1158870308 18:61680520-61680542 CCCACCCAGTAGGGAGGCTGAGG - Intergenic
1159306773 18:66653222-66653244 TCCCAGCAGTTGGGAGGCTGAGG - Intergenic
1159656467 18:71034221-71034243 TCCCACCTATCGGGAGGCTGAGG + Intergenic
1160206341 18:76836691-76836713 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1160697083 19:489873-489895 CCCTCCCAGCCAGGAGGCTGCGG + Intronic
1160709307 19:543726-543748 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1160769360 19:823324-823346 CCCAGCCAGATGGGAGGCTGAGG + Intergenic
1161033873 19:2073181-2073203 TAGTCCCAGACGGGAGACTGAGG + Exonic
1161232710 19:3182815-3182837 TAGTCCCAGTCGGGAGGCTGAGG - Intergenic
1161314943 19:3613352-3613374 TCCTCCCAGCCTGGAGCCTGAGG - Exonic
1161514247 19:4687911-4687933 TCCCACTACTCGGGAGGCTGAGG - Intronic
1161533443 19:4804120-4804142 TCCCCCAAGCCTGGAGGCAGGGG - Intergenic
1161822891 19:6541823-6541845 CCCACCCACTCGGGAGGCTGAGG + Intergenic
1162179592 19:8859021-8859043 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1162257975 19:9508322-9508344 TGCCACCAGAAGGTAGGCTGAGG - Intergenic
1162627808 19:11899546-11899568 TCCCAGCACACGGGAGACTGAGG + Intronic
1162719022 19:12650784-12650806 TCCCTCTACTCGGGAGGCTGAGG - Intronic
1162752205 19:12835633-12835655 TCCCGCCAGAAGGGAAGCGGTGG - Intronic
1162828389 19:13268547-13268569 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1162962806 19:14137678-14137700 ACGGCCCAGACGGGAGGCGGTGG - Intergenic
1162985757 19:14268507-14268529 TCCAGCCATTCGGGAGGCTGAGG + Intergenic
1163422919 19:17225058-17225080 ACATCCCAGACAGGAGGCTGAGG + Intergenic
1163830022 19:19543176-19543198 TGCCCCCAGTCTGCAGGCTGGGG - Intronic
1163874204 19:19852770-19852792 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1164046635 19:21548831-21548853 TCCACCTACTCGGGAGGCTGAGG - Intronic
1164098185 19:22030503-22030525 TCCCCACAGCTGTGAGGCTGTGG - Intergenic
1164118105 19:22241390-22241412 TCCCCACAGCTGTGAGGCTGTGG - Intergenic
1164215402 19:23140834-23140856 TCCACCTACAGGGGAGGCTGAGG + Intronic
1164985081 19:32642619-32642641 TCCCGCTACTCGGGAGGCTGAGG + Intronic
1165210895 19:34235010-34235032 TCCCAGCTGCCGGGAGGCTGAGG - Intergenic
1165501455 19:36192930-36192952 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1165654163 19:37518681-37518703 TCCTCCTACTCGGGAGGCTGAGG + Intronic
1166008291 19:39922792-39922814 TCCAGCTACACGGGAGGCTGAGG - Intronic
1166015562 19:39976963-39976985 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1166211052 19:41306698-41306720 GCCCCTCAGAGGGGAGGCAGTGG - Exonic
1166386483 19:42384957-42384979 TCCCCGCACTTGGGAGGCTGAGG - Intergenic
1166486971 19:43221993-43222015 TCCCCCCGCACTGGAGGCTCGGG + Intronic
1166694498 19:44844935-44844957 TGCCCCCTGGCGGGTGGCTGCGG + Intergenic
1167086247 19:47311678-47311700 CCCACCTAGTCGGGAGGCTGAGG - Intronic
1168234495 19:55053539-55053561 CCCCGCCACTCGGGAGGCTGAGG + Intronic
1168499504 19:56881457-56881479 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1202645981 1_KI270706v1_random:142299-142321 TCCAGCTAGTCGGGAGGCTGAGG + Intergenic
925230800 2:2232284-2232306 GCCCTCCAGCCGGGAGGCTTGGG + Intronic
926035825 2:9634929-9634951 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
926130352 2:10299515-10299537 TCCACCTACTCGGGAGGCTGAGG + Intergenic
926743767 2:16133837-16133859 TCCAGCTACACGGGAGGCTGAGG + Intergenic
927669746 2:25059226-25059248 TCCACCTACTCGGGAGGCTGAGG - Intronic
927731933 2:25481287-25481309 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
927754160 2:25695358-25695380 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
927893640 2:26767754-26767776 TAATCCCAGACTGGAGGCTGAGG + Intronic
928509067 2:31984688-31984710 CCCAGCCAGTCGGGAGGCTGAGG + Intronic
928554228 2:32406278-32406300 CCCACCTACACGGGAGGCTGAGG + Intronic
928631108 2:33193255-33193277 TCCAGCCACTCGGGAGGCTGAGG - Intronic
929132659 2:38593746-38593768 TCCACCTACTCGGGAGGCTGAGG + Intronic
929589312 2:43134709-43134731 ACCCCTCAGAGGGGAGGCAGGGG - Intergenic
930344708 2:50165462-50165484 CCCACCTAGTCGGGAGGCTGAGG - Intronic
931064831 2:58573598-58573620 TCCAGCTACACGGGAGGCTGAGG - Intergenic
931265687 2:60658165-60658187 TCCCAGCAGATGGGAGGCTGAGG - Intergenic
931301650 2:60985614-60985636 TCCCGCTACTCGGGAGGCTGAGG - Intronic
933722471 2:85407044-85407066 TCCCACTACACAGGAGGCTGAGG - Intronic
933784393 2:85827472-85827494 TCCCCCCAGCCAGTAGGCTCTGG - Intergenic
933911795 2:86947254-86947276 TCCCGCTACTCGGGAGGCTGAGG - Intronic
933913874 2:86968842-86968864 TCCGGCTACACGGGAGGCTGAGG - Intronic
934009119 2:87801056-87801078 TCCGGCTACACGGGAGGCTGAGG + Intronic
934011201 2:87822641-87822663 TCCCGCTACTCGGGAGGCTGAGG + Intronic
934865020 2:97800639-97800661 TCCCGCTACTCGGGAGGCTGAGG + Intronic
935014074 2:99163441-99163463 TCCCACTACTCGGGAGGCTGAGG - Intronic
935263382 2:101374259-101374281 TCCCGTCCAACGGGAGGCTGAGG + Intronic
935772703 2:106441746-106441768 TCCAGCTACACGGGAGGCTGAGG + Intronic
936127092 2:109797733-109797755 TCCCGCTACTCGGGAGGCTGAGG - Intronic
936129156 2:109819310-109819332 TCCAGCTACACGGGAGGCTGAGG - Intronic
936215541 2:110552175-110552197 TCCAGCTACACGGGAGGCTGAGG + Intronic
936217605 2:110573753-110573775 TCCCGCTACTCGGGAGGCTGAGG + Intronic
936424678 2:112406748-112406770 TCCAGCTACACGGGAGGCTGAGG + Intronic
936426749 2:112428326-112428348 TCCCGCTACTCGGGAGGCTGAGG + Intronic
936711938 2:115141887-115141909 CCCCCCTACACGGGAGGCTGAGG - Intronic
937200482 2:120201029-120201051 TCCAGCTACACGGGAGGCTGAGG + Intergenic
937942132 2:127294129-127294151 TCCCCCCAGAGCGGATGCCGCGG - Exonic
938050345 2:128164061-128164083 CCCAGCCAGTCGGGAGGCTGAGG + Intronic
938896369 2:135754898-135754920 TCCCACCACTGGGGAGGCTGAGG - Intronic
939306723 2:140421137-140421159 TCCATCCACTCGGGAGGCTGAGG + Intronic
939481038 2:142747407-142747429 TCCCAGCACTCGGGAGGCTGGGG + Intergenic
940119219 2:150244675-150244697 TCCCAGCTGTCGGGAGGCTGAGG + Intergenic
940264842 2:151826004-151826026 TCCAGCCACTCGGGAGGCTGAGG + Intronic
940268506 2:151865899-151865921 TCCAGCCACTCGGGAGGCTGAGG - Intronic
940359000 2:152777139-152777161 TCCAGCTACACGGGAGGCTGAGG - Intergenic
940583880 2:155618072-155618094 TCCAGCTAGTCGGGAGGCTGAGG + Intergenic
941050115 2:160723139-160723161 TAGTCCCAGACAGGAGGCTGAGG - Intergenic
942104148 2:172615505-172615527 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
944339075 2:198574166-198574188 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
944704374 2:202274340-202274362 CCCCGCCACTCGGGAGGCTGAGG - Intronic
945279650 2:208024025-208024047 TCCAGCCACAAGGGAGGCTGAGG + Intronic
945737409 2:213617455-213617477 CCCAGCCAGTCGGGAGGCTGAGG - Intronic
945962712 2:216152322-216152344 TCCAGCCACTCGGGAGGCTGAGG + Intronic
947164954 2:227252327-227252349 TCCACTTAGTCGGGAGGCTGAGG - Intronic
947165886 2:227261409-227261431 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
947522288 2:230856489-230856511 TCCCCGCAGCTGGGTGGCTGGGG + Intergenic
947789201 2:232853391-232853413 TCCCAGCACTCGGGAGGCTGAGG - Intronic
948278376 2:236727584-236727606 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
948497846 2:238365540-238365562 TCCAGCCACTCGGGAGGCTGAGG + Intronic
948530503 2:238600667-238600689 TCCCCCCACGCTGGAGGCTCGGG + Intergenic
948845137 2:240679532-240679554 TTCCCCCCAAGGGGAGGCTGAGG + Intronic
948848723 2:240695347-240695369 TTCCCCCCAAGGGGAGGCTGAGG - Intronic
949045290 2:241870022-241870044 GTCCCCGAGACGGGAGGGTGGGG + Intronic
1169120201 20:3091276-3091298 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1169180871 20:3565648-3565670 CCCCCCTAGTTGGGAGGCTGAGG + Intronic
1169299216 20:4427606-4427628 TCCAGCTACACGGGAGGCTGAGG + Intergenic
1170181680 20:13538116-13538138 TCCCCCTACTCGGGAAGCTGAGG - Intronic
1170644521 20:18185450-18185472 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1170856330 20:20059210-20059232 TCCCACTACTCGGGAGGCTGAGG + Intronic
1171803502 20:29651106-29651128 TCCCACCACTCGAGAGGCTGAGG - Intergenic
1171989172 20:31682559-31682581 CCCACCTAGTCGGGAGGCTGAGG - Intronic
1171996178 20:31733354-31733376 TCCCACCACTCAGGAGGCTGAGG - Intergenic
1172333628 20:34095426-34095448 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1172503787 20:35445851-35445873 TCCCACTATTCGGGAGGCTGAGG + Intronic
1172516322 20:35536601-35536623 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1172995231 20:39065463-39065485 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1173495911 20:43517343-43517365 TCCCACCACTTGGGAGGCTGAGG - Intronic
1173614778 20:44395510-44395532 TCCTCTCAGATGGGAGGCAGGGG + Intronic
1173646955 20:44639338-44639360 TCCCTCCAGGAGGGAGGATGCGG + Intronic
1173808499 20:45941573-45941595 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1174043396 20:47715695-47715717 CCCAGCCAGTCGGGAGGCTGAGG - Intronic
1174390565 20:50216220-50216242 ACTCCCCAGCCTGGAGGCTGTGG + Intergenic
1174489957 20:50885887-50885909 TCCCAGTAGTCGGGAGGCTGAGG + Intergenic
1174623570 20:51895795-51895817 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1174644727 20:52075972-52075994 CCCAGCCACACGGGAGGCTGAGG - Intronic
1174999650 20:55612713-55612735 TCCAGCCATTCGGGAGGCTGAGG + Intergenic
1175143240 20:56876157-56876179 TCCAGCTACACGGGAGGCTGAGG - Intergenic
1175364342 20:58441524-58441546 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1175566118 20:59978489-59978511 TCCCACTACTCGGGAGGCTGAGG - Intronic
1175822432 20:61917589-61917611 TCCCCTCCGATGGGAGGCTCAGG - Intronic
1175875605 20:62227929-62227951 CCCACCCAGGCGGGAGGCAGGGG - Intergenic
1175938306 20:62525323-62525345 TCCCCCGAGCCGGGAGGATCTGG - Intergenic
1176059497 20:63166194-63166216 TCCCTCCACATGGGAGGGTGGGG + Intergenic
1176443317 21:6798445-6798467 TCCTAGCAGGCGGGAGGCTGAGG - Intergenic
1176605898 21:8830448-8830470 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
1176821485 21:13663492-13663514 TCCTAGCAGGCGGGAGGCTGAGG - Intergenic
1176873033 21:14099287-14099309 TCTCATCAGAAGGGAGGCTGGGG + Intergenic
1176906571 21:14508998-14509020 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
1177635748 21:23784704-23784726 GCCACCTAGTCGGGAGGCTGAGG + Intergenic
1177724471 21:24949218-24949240 TCCCAGCACATGGGAGGCTGAGG - Intergenic
1178123496 21:29493365-29493387 TCCAGCTACACGGGAGGCTGAGG - Intronic
1179827935 21:43978416-43978438 TCCAGCCACCCGGGAGGCTGAGG - Intronic
1180348196 22:11722054-11722076 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
1181263837 22:21618447-21618469 TCCCACTACCCGGGAGGCTGAGG + Intronic
1181387989 22:22558614-22558636 TCCCACCAGACAGTAGGGTGGGG + Intronic
1181739673 22:24910827-24910849 TCCAGCTACACGGGAGGCTGCGG + Intronic
1181861379 22:25821659-25821681 TCCAGCTACACGGGAGGCTGAGG + Intronic
1181904062 22:26179136-26179158 TCCCAGCAGTTGGGAGGCTGAGG + Intronic
1181956615 22:26591790-26591812 TCCCCCTACTTGGGAGGCTGAGG + Intronic
1182276299 22:29190811-29190833 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1182336328 22:29585882-29585904 CCCAGCTAGACGGGAGGCTGAGG - Intergenic
1182498525 22:30728277-30728299 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1182564024 22:31184227-31184249 ACCTCCCAGACGGGTGGCGGTGG + Intronic
1183066031 22:35363474-35363496 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1183186607 22:36295090-36295112 TCCCCTCAGAGTGGAGGCCGGGG + Intronic
1183355571 22:37357280-37357302 TCACGCTAGACGGGAGGTTGGGG + Intergenic
1183511503 22:38237915-38237937 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1183984359 22:41561480-41561502 GCTTCCCAGACAGGAGGCTGCGG - Intronic
1184324300 22:43771312-43771334 TCCCACTATTCGGGAGGCTGAGG + Intronic
1184462788 22:44648777-44648799 CTCCCCCAGGCTGGAGGCTGGGG - Intergenic
1184550564 22:45202322-45202344 TTCCCCAGGGCGGGAGGCTGAGG - Intronic
1185303209 22:50094970-50094992 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1185360091 22:50401320-50401342 TCCAGCTACACGGGAGGCTGAGG - Intronic
1185361521 22:50410600-50410622 ATCCCCCAGACGGGAGGCTGAGG - Intronic
949536350 3:4999027-4999049 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
949995350 3:9612237-9612259 TCCAGCGAGTCGGGAGGCTGAGG - Intergenic
951185576 3:19708820-19708842 TCCCCCTACTCAGGAGGCTGAGG + Intergenic
951203007 3:19895363-19895385 TCCCACTACTCGGGAGGCTGAGG + Intronic
951576128 3:24116016-24116038 CCCAGCCACACGGGAGGCTGAGG - Intergenic
951873773 3:27397142-27397164 TCCCGCTACTCGGGAGGCTGAGG - Intronic
952272391 3:31846126-31846148 CCCCGCCACGCGGGAGGCTGAGG - Intronic
952348941 3:32515948-32515970 TCCCAGCTGCCGGGAGGCTGAGG + Intergenic
953227626 3:41034971-41034993 GCCCCCCAGAGTGGAGTCTGAGG + Intergenic
953364493 3:42331419-42331441 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
953985709 3:47441015-47441037 CCCCGCCACTCGGGAGGCTGAGG - Intronic
954109211 3:48424892-48424914 TCCCCCCAGATCAGAGGGTGAGG + Intronic
954585942 3:51736943-51736965 TCCCAGCACTCGGGAGGCTGAGG - Intergenic
954617456 3:51976557-51976579 TCCCACTATTCGGGAGGCTGAGG + Intronic
954899520 3:54007010-54007032 TCCAGCTAGGCGGGAGGCTGAGG - Intergenic
955753696 3:62206814-62206836 TCCAGCCACTCGGGAGGCTGAGG + Intronic
956282882 3:67577190-67577212 TACTCCCAGTCGGGAGGCTGAGG + Intronic
956898856 3:73692914-73692936 ACCCCAAAGATGGGAGGCTGGGG + Intergenic
957595035 3:82252717-82252739 TCCACCTACTCGGGAGGCTGAGG - Intergenic
958125795 3:89352785-89352807 TCCAGCTACACGGGAGGCTGAGG + Intronic
958192402 3:90199572-90199594 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
958415811 3:93871507-93871529 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
959184719 3:103032017-103032039 CCCAGCCAGTCGGGAGGCTGAGG - Intergenic
959239835 3:103775938-103775960 TCCAGCCACTCGGGAGGCTGGGG + Intergenic
960102174 3:113755483-113755505 TCCCGCTATTCGGGAGGCTGAGG + Intronic
960156322 3:114300262-114300284 TCCACCCACTCGGGAGACTGTGG + Intronic
960260788 3:115565929-115565951 TCCACCTACTCGGGAGGCTGAGG + Intergenic
960781953 3:121329742-121329764 TCCACCTACACGGGAGGCTGAGG + Intronic
961490229 3:127252168-127252190 TCCCTGAAGAAGGGAGGCTGGGG + Intergenic
961601794 3:128068079-128068101 TGTCCACAGACGGGAGGTTGGGG - Intronic
961699181 3:128728576-128728598 TCCAGCCACTCGGGAGGCTGAGG - Intronic
961704689 3:128774894-128774916 CCCAGCCATACGGGAGGCTGAGG - Intronic
962459240 3:135593539-135593561 CCGGCCCAGTCGGGAGGCTGGGG + Intergenic
962817782 3:139018142-139018164 TCCAATCAGATGGGAGGCTGAGG - Intronic
963184727 3:142401600-142401622 TCCAGCCACTCGGGAGGCTGAGG + Intronic
963783570 3:149510867-149510889 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
964382544 3:156112243-156112265 TCCAGCTACACGGGAGGCTGAGG - Intronic
965484293 3:169259611-169259633 TCCAGCCACTCGGGAGGCTGAGG + Intronic
965717351 3:171619831-171619853 TCCCAGCACACGGGAGACTGAGG + Intronic
966409405 3:179632970-179632992 TCCAGCTAGTCGGGAGGCTGAGG + Intergenic
967165781 3:186778359-186778381 TCCCACTACTCGGGAGGCTGAGG + Intergenic
967341915 3:188407903-188407925 TCCAGCTATACGGGAGGCTGAGG - Intronic
967955543 3:194874872-194874894 TCCGCCCACACATGAGGCTGAGG + Intergenic
968211899 3:196855687-196855709 TCCAGCTAGTCGGGAGGCTGAGG + Intergenic
968213457 3:196868229-196868251 TCCCCCGGAAAGGGAGGCTGTGG - Intronic
969221302 4:5760666-5760688 TCCAGCCACTCGGGAGGCTGAGG - Intronic
973268661 4:48237078-48237100 TCCCACCACTTGGGAGGCTGAGG + Intronic
973372207 4:49260534-49260556 TCCAGCTAGTCGGGAGGCTGAGG + Intergenic
973388790 4:49534601-49534623 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
973623499 4:52750112-52750134 TCCAGCTAGCCGGGAGGCTGAGG - Intronic
974311699 4:60219628-60219650 TCCACCCATTCAGGAGGCTGAGG + Intergenic
976264345 4:83176118-83176140 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
977053357 4:92158519-92158541 CCCCGCCACTCGGGAGGCTGAGG - Intergenic
977317038 4:95463216-95463238 CACCCGCAGACGGGTGGCTGCGG + Intronic
977814615 4:101400340-101400362 TTCCCCCTGAAGGGAGGCTGAGG + Intergenic
979237309 4:118415866-118415888 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
979474592 4:121140216-121140238 CCCAGCCAGTCGGGAGGCTGAGG + Intronic
980038197 4:127908959-127908981 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
980102677 4:128557370-128557392 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
980102973 4:128560137-128560159 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
980428239 4:132655062-132655084 CCCAGCCACACGGGAGGCTGAGG + Intergenic
980740107 4:136939262-136939284 TGACCCCAGAGTGGAGGCTGTGG + Intergenic
980948374 4:139346661-139346683 TCCCACTACTCGGGAGGCTGAGG - Intronic
981202638 4:141998954-141998976 TCCCACCACTTGGGAGGCTGAGG - Intergenic
981768623 4:148280755-148280777 TCCCCACATGTGGGAGGCTGAGG - Intronic
983225957 4:165086539-165086561 TAATCCCAGTCGGGAGGCTGAGG - Intronic
983585562 4:169350704-169350726 TCCCAGCAAACGGGAGGCTGAGG - Intergenic
983882811 4:172952235-172952257 TCCCCCCAGGCAGCAGGCGGGGG - Exonic
983904521 4:173169469-173169491 CACCCCCAGACGGGCGGCTGCGG - Intronic
983991160 4:174121757-174121779 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
985010039 4:185573108-185573130 TCCCAGCTGACAGGAGGCTGAGG - Intergenic
985015525 4:185629809-185629831 TCCCAGCAGTTGGGAGGCTGAGG - Intronic
985283866 4:188314112-188314134 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
985652751 5:1114511-1114533 TCCTCCCACACGGCAGCCTGGGG + Intergenic
985828780 5:2212950-2212972 GCCCCCCAGAGAGGAGGCAGAGG + Intergenic
986057767 5:4155416-4155438 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
986417467 5:7543896-7543918 TCCACCTACTCGGGAGGCTGAGG + Intronic
986527995 5:8701521-8701543 TCTCCCCAGATAGGAAGCTGGGG + Intergenic
986712469 5:10498039-10498061 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
986713211 5:10502721-10502743 TCACCCCTGATGGGAGGCAGAGG + Intergenic
987109360 5:14670718-14670740 CCCCCCTAGAAAGGAGGCTGAGG - Intronic
987146007 5:14992433-14992455 CCCACCTAGTCGGGAGGCTGAGG - Intergenic
987367200 5:17159431-17159453 TCCCGACTGTCGGGAGGCTGAGG - Intronic
987789970 5:22552542-22552564 TCCAGCTATACGGGAGGCTGAGG - Intronic
989216628 5:38910892-38910914 CCCAGCCAGTCGGGAGGCTGAGG + Intronic
989316816 5:40090709-40090731 TCCCAGCACTCGGGAGGCTGAGG - Intergenic
990425821 5:55687812-55687834 TCCCAGCACTCGGGAGGCTGAGG - Intronic
990523596 5:56603666-56603688 TCCCAGCACCCGGGAGGCTGAGG + Intronic
990955825 5:61337161-61337183 TCCCGCCGCTCGGGAGGCTGGGG + Intronic
991082821 5:62619735-62619757 CCCACCTAGTCGGGAGGCTGAGG + Intronic
991394081 5:66185255-66185277 CCCAGCCAGTCGGGAGGCTGAGG - Intergenic
991676243 5:69092334-69092356 TCCCAGCAGTTGGGAGGCTGAGG - Intergenic
992635583 5:78723104-78723126 TCCAGCTACACGGGAGGCTGAGG + Intronic
992870734 5:81003169-81003191 TCCCGCTACTCGGGAGGCTGAGG - Intronic
993099214 5:83516166-83516188 TAGTCCCAGTCGGGAGGCTGAGG + Intronic
993283063 5:85952551-85952573 TCCCACTACTCGGGAGGCTGAGG - Intergenic
994043438 5:95284046-95284068 TCCCCCCTCGGGGGAGGCTGGGG + Exonic
994126566 5:96173854-96173876 CCCACCTAGTCGGGAGGCTGAGG - Intergenic
994146083 5:96396443-96396465 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
996671250 5:126120550-126120572 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
996824383 5:127664792-127664814 GCCCCCCAGCCTGGAGTCTGAGG + Intergenic
997119758 5:131162205-131162227 TCCCACTACTCGGGAGGCTGAGG + Intronic
997120960 5:131172295-131172317 TCCCGCTACTCGGGAGGCTGAGG + Intronic
997682083 5:135763986-135764008 CCCCCGCACTCGGGAGGCTGAGG - Intergenic
999528979 5:152440970-152440992 CCCAGCCAGTCGGGAGGCTGAGG - Intergenic
999723353 5:154415452-154415474 TCCACCTACTCGGGAGGCTGAGG - Intronic
1000065264 5:157688702-157688724 CCCAGCCACACGGGAGGCTGAGG + Intergenic
1000795140 5:165655871-165655893 TTCCCCCTGCCGGGAGACTGTGG + Intergenic
1001761118 5:174209204-174209226 TCCCCCCAGGCCAGAGGCTGAGG + Intronic
1001828578 5:174766586-174766608 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1002254248 5:177947438-177947460 TCCCACTATCCGGGAGGCTGAGG - Intergenic
1002382945 5:178843263-178843285 CCCACCCACTCGGGAGGCTGAGG + Intergenic
1002964133 6:1945657-1945679 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1003161635 6:3640152-3640174 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1003883307 6:10497856-10497878 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1004202744 6:13564743-13564765 CCCAGCCATACGGGAGGCTGAGG - Intergenic
1006387407 6:33739010-33739032 TACCCCCAGCCAGGAGGCTGTGG - Intronic
1006607872 6:35271987-35272009 TCCACCTACTCGGGAGGCTGAGG + Intronic
1007379420 6:41478017-41478039 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1007586391 6:42992705-42992727 TCCAGCCACACGGGAGGCTGAGG + Intronic
1007591350 6:43022746-43022768 TCCCACTACTCGGGAGGCTGAGG - Intronic
1008020030 6:46565869-46565891 TCTCCCCAAGCTGGAGGCTGGGG - Intronic
1008456244 6:51714252-51714274 TCCACCTACTCGGGAGGCTGAGG + Intronic
1010232999 6:73552106-73552128 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1010961329 6:82149024-82149046 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1011633628 6:89351192-89351214 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1011826913 6:91318567-91318589 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1012234073 6:96792244-96792266 TCCCTGCAGTTGGGAGGCTGAGG - Intergenic
1012633678 6:101507799-101507821 TGCCCCCAGAAGGGAGGCAAGGG + Intronic
1013199511 6:107879440-107879462 TCCCACCACTCAGGAGGCTGAGG - Intronic
1013509085 6:110828314-110828336 TCCACCTACTCGGGAGGCTGAGG + Intronic
1013523199 6:110951520-110951542 TAGTCCCAGCCGGGAGGCTGAGG - Intergenic
1013808539 6:114019116-114019138 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1014003425 6:116390317-116390339 TCCCAGCAGTTGGGAGGCTGAGG - Intronic
1014936691 6:127394106-127394128 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1015091222 6:129361898-129361920 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1016330677 6:142948939-142948961 CCCCTCCACTCGGGAGGCTGAGG - Intergenic
1016359785 6:143254919-143254941 TCCCAGCTGTCGGGAGGCTGAGG + Intronic
1016403403 6:143704941-143704963 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1016435596 6:144034200-144034222 GCACCCCAGGAGGGAGGCTGGGG - Intronic
1016504324 6:144761528-144761550 TCCCAGCAGTCAGGAGGCTGAGG + Intronic
1016946582 6:149540011-149540033 TCCCGCTACTCGGGAGGCTGAGG + Intronic
1016957100 6:149637294-149637316 TCCACCCACTCAGGAGGCTGAGG + Intronic
1017780958 6:157714925-157714947 TCCACCCACTCAGGAGGCTGAGG + Intronic
1018092670 6:160358637-160358659 TCCCCCCATCCGGGTGGCTCTGG + Intronic
1018443769 6:163836291-163836313 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1019130735 6:169871828-169871850 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1019422259 7:956227-956249 CTCCCTCAGACGGGAGGCTTTGG + Intronic
1019423752 7:963565-963587 CCCACTCAGAGGGGAGGCTGGGG - Intronic
1019525624 7:1479235-1479257 TCCCCCGGGACGGGAGGTGGGGG - Intronic
1019623109 7:2002207-2002229 TCCCCAGAGAGTGGAGGCTGCGG - Intronic
1019710951 7:2518096-2518118 ACCCCTCAGTCCGGAGGCTGGGG + Intronic
1019716400 7:2541380-2541402 GCCCCCCACACTGGAGGCAGGGG + Exonic
1019771384 7:2885720-2885742 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1020043095 7:5018891-5018913 TCCACCTACTCGGGAGGCTGAGG + Intronic
1020191138 7:5998872-5998894 TCCCACTACTCGGGAGGCTGAGG + Intronic
1020201423 7:6083038-6083060 TCCATCTACACGGGAGGCTGAGG - Intergenic
1020604247 7:10316025-10316047 GCCACCCAGAAGGGATGCTGAGG - Intergenic
1020791030 7:12628356-12628378 TCTCACCAGTCTGGAGGCTGGGG + Intronic
1021055021 7:16036298-16036320 GCCCCTCAGTCGGGAGGCTGAGG + Intergenic
1021284644 7:18765501-18765523 TCCCAACTGACGGGAGGCTGAGG + Intronic
1021361444 7:19717965-19717987 CCCCCCTACTCGGGAGGCTGAGG - Intergenic
1021555801 7:21916410-21916432 TTCCCACAGAGGCGAGGCTGCGG - Intronic
1022031603 7:26496630-26496652 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1022048367 7:26641550-26641572 TCCACCTACTCGGGAGGCTGAGG + Intronic
1022287206 7:28964980-28965002 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1023018884 7:35992089-35992111 TCCTCCCACCCAGGAGGCTGAGG + Intergenic
1023050669 7:36248319-36248341 TCCAGCTAGTCGGGAGGCTGAGG - Intronic
1023707076 7:42952345-42952367 TCCACCTAGTCAGGAGGCTGAGG - Intergenic
1024029450 7:45445642-45445664 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1024307529 7:47940856-47940878 TCCACCCGGCTGGGAGGCTGAGG + Intronic
1025085722 7:56021832-56021854 CCCACCCACTCGGGAGGCTGAGG + Intronic
1025225101 7:57151419-57151441 TCCAGCCACACGGGAGGCTGAGG - Intergenic
1025928181 7:65975498-65975520 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1026103457 7:67401840-67401862 TCCCAGCACATGGGAGGCTGAGG + Intergenic
1026239435 7:68559367-68559389 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1026500534 7:70939715-70939737 TCCCAGCACTCGGGAGGCTGAGG - Intergenic
1026965187 7:74434932-74434954 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1027260044 7:76458386-76458408 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1027268476 7:76506803-76506825 TCCCAGCGGTCGGGAGGCTGAGG + Intergenic
1027282427 7:76618503-76618525 TCCACCTACTCGGGAGGCTGAGG + Intronic
1027311419 7:76956490-76956512 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1027390612 7:77699910-77699932 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1028621934 7:92835406-92835428 GCCCCCCAGACGGTCGGCTTCGG + Intronic
1029085997 7:98012210-98012232 CCCCACCAGATGAGAGGCTGAGG - Intergenic
1029190085 7:98765618-98765640 TCCCGCCACTTGGGAGGCTGAGG - Intergenic
1029408134 7:100390132-100390154 AACCCCCAGATGGGAGGCTTGGG - Intronic
1029469372 7:100744480-100744502 TCCCAACACTCGGGAGGCTGAGG + Intronic
1029746887 7:102520665-102520687 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1029764840 7:102619754-102619776 TCCCACTACTCGGGAGGCTGAGG + Intronic
1031729637 7:125282788-125282810 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1032947357 7:136869495-136869517 TCCCCCCAAGCCGGAGGCTCAGG + Intronic
1033182593 7:139195596-139195618 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1034369908 7:150585849-150585871 TCCACCCAGAAGGGATACTGAGG + Intergenic
1034650616 7:152687324-152687346 TCCCAACACTCGGGAGGCTGCGG + Intergenic
1034772075 7:153788847-153788869 TCCAGCTAGTCGGGAGGCTGAGG + Intergenic
1035658351 8:1328432-1328454 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1035957144 8:4093842-4093864 TCCCAGCAATCGGGAGGCTGAGG + Intronic
1036206897 8:6812089-6812111 TCCCCCCAGAGGCTGGGCTGGGG - Exonic
1036609734 8:10339655-10339677 CCCACCTAGTCGGGAGGCTGAGG - Intronic
1037140440 8:15512655-15512677 TCCAGCTAGATGGGAGGCTGAGG + Intronic
1037271502 8:17135280-17135302 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1037424207 8:18737438-18737460 TCCCACCTCTCGGGAGGCTGAGG - Intronic
1037508309 8:19555121-19555143 TCCCACTAGTCAGGAGGCTGAGG + Intronic
1037815223 8:22108425-22108447 TCCACCCAGAGGGGAGTCTTGGG - Intronic
1038041226 8:23725932-23725954 TCCCGCTACTCGGGAGGCTGAGG - Intergenic
1038842179 8:31195044-31195066 TCCAGCTACACGGGAGGCTGAGG + Intergenic
1039027819 8:33277119-33277141 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1039054871 8:33527887-33527909 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1039067861 8:33624589-33624611 CCCAGCCAGTCGGGAGGCTGAGG + Intergenic
1039707746 8:40024531-40024553 CCCAGCCAGTCGGGAGGCTGAGG + Intergenic
1041354076 8:56981447-56981469 TCCAACCACTCGGGAGGCTGAGG + Intronic
1042659611 8:71140191-71140213 TCTCCCCAGAGGGGAAGATGAGG + Intergenic
1043383018 8:79723101-79723123 TCCCAGCAGACAGGAGGCAGGGG + Intergenic
1044665697 8:94632415-94632437 TCCACCTACTCGGGAGGCTGAGG + Intergenic
1044742902 8:95345560-95345582 TCTTCCCAGACTGGAGCCTGGGG + Intergenic
1045225937 8:100245594-100245616 GCTACCCAGGCGGGAGGCTGAGG - Intronic
1045935855 8:107677998-107678020 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1047081833 8:121471293-121471315 TGCTCCCAGAGGGGAGGCTGTGG - Intergenic
1047227491 8:122969043-122969065 TCCAGCCATTCGGGAGGCTGAGG + Intronic
1047370026 8:124248285-124248307 TCCCGCCACTTGGGAGGCTGAGG + Intergenic
1047457473 8:125029145-125029167 CCCAGCCAGTCGGGAGGCTGAGG - Intronic
1049043942 8:140134380-140134402 TCCCACTACTCGGGAGGCTGAGG - Intronic
1049063980 8:140298534-140298556 CCCACCCACTCGGGAGGCTGAGG + Intronic
1049519216 8:143079768-143079790 TCCTCCCACAGGTGAGGCTGGGG - Intergenic
1049725825 8:144145564-144145586 CCCAGCCAGTCGGGAGGCTGAGG + Intergenic
1050476655 9:6047693-6047715 CCCCCCTACTCGGGAGGCTGAGG + Intergenic
1050552148 9:6758014-6758036 ACCCCCTCGACGGGAGGGTGAGG + Intronic
1050870594 9:10564113-10564135 TCCCAGCACTCGGGAGGCTGAGG - Intronic
1052306393 9:27014723-27014745 TCCCACTACTCGGGAGGCTGAGG - Intronic
1052870252 9:33499293-33499315 TCCCAACATATGGGAGGCTGAGG + Intergenic
1052954748 9:34245025-34245047 TAGTCCCAGACAGGAGGCTGAGG - Intronic
1052958536 9:34274153-34274175 TAGTCCCAGACAGGAGGCTGAGG + Intronic
1053015107 9:34657403-34657425 TCCTCCTAGAAGGGAGGATGTGG - Exonic
1053157802 9:35792317-35792339 ACCCCCCAGCCTGGAGCCTGGGG - Exonic
1053238531 9:36477206-36477228 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1053356839 9:37453301-37453323 TCCCAGCCAACGGGAGGCTGAGG - Intronic
1053798384 9:41746696-41746718 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1054186799 9:61958747-61958769 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1054651708 9:67629773-67629795 TCCACCTACTCGGGAGGCTGAGG + Intergenic
1054818076 9:69495171-69495193 TTACCCCAGACAGGAGGCAGTGG - Intronic
1055305269 9:74923134-74923156 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1055309113 9:74960111-74960133 TCCCAGCATAAGGGAGGCTGAGG + Intergenic
1055529367 9:77168434-77168456 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1056452503 9:86729634-86729656 TCCCAGCACTCGGGAGGCTGAGG + Intergenic
1057059579 9:91991521-91991543 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1057313316 9:93954757-93954779 GCCCTCCAGGCGGGAGGCGGAGG - Intronic
1057464435 9:95299743-95299765 TCCAGCTACACGGGAGGCTGAGG + Intronic
1057905539 9:98980348-98980370 AGCCCCCAGAGGGGAGGGTGTGG + Intronic
1058895320 9:109395970-109395992 TCCAGCTACACGGGAGGCTGAGG - Intronic
1059296119 9:113272300-113272322 TCCCAGCACGCGGGAGGCTGAGG + Intronic
1059365077 9:113780701-113780723 TGTCCCCAGATAGGAGGCTGGGG + Intergenic
1059380188 9:113917359-113917381 CCTCCCTACACGGGAGGCTGAGG - Intronic
1060634360 9:125188666-125188688 TCCACCTAGTCGGGAGGCTGAGG + Intronic
1061178379 9:129010509-129010531 TCCCCACAGAGGGGAAACTGAGG + Intronic
1061323623 9:129848697-129848719 TCTCTCCAGTCGGGTGGCTGGGG - Intronic
1061369693 9:130191452-130191474 TCCCACCAGCCCGGAGGCTCTGG + Intronic
1061568651 9:131461655-131461677 TCCCGCTACTCGGGAGGCTGAGG - Intronic
1061694792 9:132364677-132364699 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1061709103 9:132475449-132475471 TCCCCTCAGCAGGGAGACTGTGG - Intronic
1062607930 9:137356355-137356377 TCCCCACAGACGGTACCCTGAGG - Exonic
1203525884 Un_GL000213v1:86082-86104 TCCTAGCAGGCGGGAGGCTGAGG + Intergenic
1203553294 Un_KI270743v1:182466-182488 TCCAGCTAGTCGGGAGGCTGAGG - Intergenic
1185445801 X:257521-257543 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1185483222 X:463598-463620 TCCAGCTAGTCGGGAGGCTGAGG + Intergenic
1185560554 X:1057292-1057314 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1185673506 X:1830328-1830350 TCCAGCCACTCGGGAGGCTGAGG + Intergenic
1186407228 X:9314842-9314864 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1187161156 X:16766605-16766627 TCCCGCTACTCGGGAGGCTGAGG + Intergenic
1187709632 X:22040389-22040411 TCCAGCCACATGGGAGGCTGAGG + Intronic
1189037383 X:37506409-37506431 TCCCAGCACATGGGAGGCTGAGG + Intronic
1189471720 X:41319926-41319948 TCCAGCTACACGGGAGGCTGAGG - Intergenic
1189549524 X:42078529-42078551 TCCAGCCACTCGGGAGGCTGGGG - Intergenic
1189914870 X:45847167-45847189 CCCACACAGTCGGGAGGCTGAGG - Intergenic
1190343705 X:49318416-49318438 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190344801 X:49327944-49327966 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190345894 X:49337501-49337523 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190346997 X:49347051-49347073 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1190347149 X:49528523-49528545 TCCAGCCACTCGGGAGGCTGAGG - Intergenic
1190348248 X:49538078-49538100 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190349349 X:49547634-49547656 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190350453 X:49557190-49557212 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190351555 X:49566745-49566767 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190352655 X:49576302-49576324 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190353756 X:49585850-49585872 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190354858 X:49595372-49595394 TCCAGCCACTCGGGAGGCTGAGG - Intronic
1190650003 X:52559713-52559735 CCCACCCAATCGGGAGGCTGAGG + Intergenic
1191831661 X:65421830-65421852 TCCCAGCACTCGGGAGGCTGAGG + Intronic
1192220130 X:69192104-69192126 ACTCCCCAGATGGGAAGCTGAGG + Intergenic
1192396510 X:70787016-70787038 TCCAGCCACTCGGGAGGCTGAGG + Intronic
1192485168 X:71518809-71518831 TCCACCTACTCGGGAGGCTGAGG - Intronic
1192593643 X:72383752-72383774 TCCAGCTAGTCGGGAGGCTGAGG + Intronic
1192792857 X:74400006-74400028 CCCCGCTAGTCGGGAGGCTGAGG + Intergenic
1192805466 X:74504872-74504894 CCCAGCCACACGGGAGGCTGAGG + Intronic
1192841619 X:74863054-74863076 CCCCCCTATTCGGGAGGCTGAGG + Intronic
1193212973 X:78829206-78829228 TCCCACTACTCGGGAGGCTGAGG + Intergenic
1194035036 X:88860352-88860374 TAGCCCCAGTCTGGAGGCTGAGG + Intergenic
1195045023 X:101047713-101047735 TCCCACTACTCGGGAGGCTGAGG + Intronic
1195114353 X:101682003-101682025 TCCACCTACCCGGGAGGCTGAGG + Intergenic
1195905190 X:109837504-109837526 ACCCGCCACTCGGGAGGCTGAGG + Intergenic
1197549693 X:127874614-127874636 CCCCGCCACTCGGGAGGCTGAGG - Intergenic
1197777688 X:130130067-130130089 TCCCCCTGGACGGGAGCCTGTGG + Exonic
1198259178 X:134950985-134951007 TCCACCTACTCGGGAGGCTGAGG - Intergenic
1198325216 X:135564614-135564636 TCCCACTACTCGGGAGGCTGAGG + Intronic
1198341545 X:135719436-135719458 TCCCGCTACTCGGGAGGCTGCGG - Intronic
1198346453 X:135763925-135763947 TCCCGCTACTCGGGAGGCTGCGG + Intronic
1198348359 X:135781210-135781232 TCCCGCTACTCGGGAGGCTGCGG + Intergenic
1198350263 X:135798472-135798494 TCCCGCTACTCGGGAGGCTGCGG + Intronic
1198352171 X:135815746-135815768 TCCCGCTACTCGGGAGGCTGCGG + Intronic
1198354079 X:135833014-135833036 TCCCGCTACTCGGGAGGCTGCGG + Intronic
1198355989 X:135850263-135850285 TCCCGCTACTCGGGAGGCTGCGG + Intronic
1198357902 X:135867543-135867565 TCCCGCTACTCGGGAGGCTGCGG + Intergenic
1198359816 X:135884825-135884847 TCCCGCTACTCGGGAGGCTGCGG + Intronic
1198386958 X:136138105-136138127 CCCCCCTACTCGGGAGGCTGAGG + Intergenic
1199034347 X:143032980-143033002 TCCCCTGAGAAGGCAGGCTGCGG + Intronic
1199215268 X:145254608-145254630 TCCCCTGAGAAGGGAGGCTGCGG + Intronic
1199363324 X:146947339-146947361 TCCCCCTACTCGGGAAGCTGAGG - Intergenic
1200158408 X:153990808-153990830 TCCCACTACTCGGGAGGCTGAGG - Intergenic
1201056930 Y:10003189-10003211 TCCAGCCACATGGGAGGCTGAGG - Intergenic
1201768547 Y:17595658-17595680 TCTCATCAGAGGGGAGGCTGGGG + Intergenic
1201833007 Y:18310327-18310349 TCTCATCAGAGGGGAGGCTGGGG - Intergenic
1201914494 Y:19167772-19167794 TTCCCCAACACAGGAGGCTGAGG + Intergenic
1202055795 Y:20828259-20828281 TCCCACTATTCGGGAGGCTGAGG - Intergenic