ID: 1081812861

View in Genome Browser
Species Human (GRCh38)
Location 11:45923050-45923072
Sequence TCCGCAGCCTCCCGTCTGGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 280}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812861_1081812868 4 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812861_1081812876 17 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812861_1081812878 19 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812861_1081812875 11 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812861_1081812877 18 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812877 11:45923091-45923113 GAGACCCGGGGGCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 317
1081812861_1081812869 5 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812861_1081812872 7 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812861_1081812866 -4 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812861_1081812871 6 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812861 Original CRISPR TCCGCAGCCTCCCGTCTGGG GGG (reversed) Exonic
900217907 1:1491414-1491436 GCCTCAGCCTCCCGTGTGGCTGG - Intronic
900607432 1:3530145-3530167 TAGGCAGCCTTCCGGCTGGGCGG - Intronic
900728196 1:4232551-4232573 TCCTCAGCCTCCCGTGTAGCTGG - Intergenic
901083637 1:6597637-6597659 TAAGGAGCCTCCTGTCTGGGGGG + Intronic
901592484 1:10356992-10357014 TCCTCAGCCTCCCGAATAGGTGG + Intronic
901951893 1:12755937-12755959 TCTGCAGCCCCCGGGCTGGGAGG - Intronic
903146429 1:21375690-21375712 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
903629736 1:24758569-24758591 GCCTCAGCCTCCCGACTGGCTGG + Intronic
904246519 1:29191975-29191997 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
905224488 1:36470297-36470319 GCCGCAGCCTCCCGACTAGCTGG + Intronic
905315796 1:37081056-37081078 CCAGCCGCCCCCCGTCTGGGAGG + Intergenic
905476673 1:38233553-38233575 GCCTCAGCCTCCCGACTAGGTGG - Intergenic
905871668 1:41407909-41407931 TCCCCAGCCTCCTGTGGGGGAGG + Intergenic
906304712 1:44709555-44709577 GCCTCAGCCTCCCGTGTAGGTGG - Intronic
906313046 1:44767471-44767493 TCCGCAGCATCCTGCCTGCGTGG + Exonic
907526366 1:55056351-55056373 TCCCCAGCCTCCCGCATGGCGGG - Intronic
908128248 1:61050835-61050857 TCCGCGGCCTCCCGCCCGGGGGG - Intronic
908524828 1:64977543-64977565 GCCTCAGCCTCCCGACTAGGTGG + Intergenic
909527128 1:76637941-76637963 GCCTCAGCCTCCCGTCTAGCTGG + Intergenic
915490344 1:156247020-156247042 GAGGCAGCCTCCCGGCTGGGAGG - Intronic
916279413 1:163032638-163032660 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
922705196 1:227786970-227786992 TCCGCACCCACCACTCTGGGAGG + Intergenic
922821090 1:228486585-228486607 TCCGCTGTCTCCTGGCTGGGGGG - Intergenic
923589928 1:235309395-235309417 CCGGCAGCCACCCGTCCGGGAGG + Intronic
1063452673 10:6161745-6161767 ACCTCAGCCTCCCGAGTGGGTGG + Intronic
1064182783 10:13133921-13133943 TCCACAGCCTCCCGAGTGGCTGG + Intronic
1064281720 10:13957366-13957388 GCCTCAGCCTCCCGTCTAGCTGG + Intronic
1064850746 10:19706463-19706485 TCCCCAGCCTCCCTTGTAGGTGG + Intronic
1065073527 10:22052769-22052791 TCCCCAGCCTCCATTCCGGGAGG + Intergenic
1065260591 10:23919489-23919511 TCCGCAGCCTCCCGAGTAGCTGG - Intronic
1065960070 10:30726943-30726965 GCCACAGCCTTCCGTCTGCGCGG - Intergenic
1066976347 10:42371363-42371385 GCCTCAGCCTCCCGTGTGGCTGG + Intergenic
1067105094 10:43361287-43361309 TCACCTGCCTCCCCTCTGGGAGG - Intergenic
1068673230 10:59744346-59744368 CCCGCCGCCACCCGTCTGGGAGG + Intergenic
1069317481 10:67124949-67124971 TCCCAAGCCTCCTGTCTGAGAGG - Intronic
1069462126 10:68605356-68605378 ACCGCAGCCTCCCGAGTAGGTGG - Intronic
1069993498 10:72328998-72329020 TCCGCAGGCTGCAGTCAGGGTGG + Intergenic
1071644566 10:87349738-87349760 GCCGCAGCCTCCCGTGTAGCTGG - Intergenic
1073407040 10:103307320-103307342 GCCTCAGCCTCCCGTGTGGCTGG - Intronic
1074395764 10:113096832-113096854 TCCCCACCCTCCCCTCTGGAGGG - Intronic
1074824021 10:117201906-117201928 TCCCCAGCTTCCCTTCTGGTGGG + Intronic
1074873306 10:117594828-117594850 TTCGCAGCCACCCGTCAGGGAGG - Intergenic
1077321085 11:1942266-1942288 AACGCAGCCTCCCATGTGGGTGG + Intergenic
1077441633 11:2571731-2571753 TCCCCAGACTGCCTTCTGGGGGG - Intronic
1079163266 11:18013273-18013295 CCCGCAGCCTCCTGTCTCGCTGG + Intergenic
1079328493 11:19514481-19514503 TCCGCAGCTTCCAGGCTGTGTGG - Intronic
1079442458 11:20528751-20528773 GCCTCAGCCTCCCGTGTAGGTGG - Intergenic
1081812861 11:45923050-45923072 TCCGCAGCCTCCCGTCTGGGGGG - Exonic
1081858619 11:46319332-46319354 TTCGCATCCTCCCTTCAGGGAGG + Intronic
1081900346 11:46622230-46622252 GCCTCAGCCTCCCGTCTAGCTGG + Intronic
1081923630 11:46803381-46803403 ACCTCAGCCTCCCGACTGGCTGG + Intronic
1081946156 11:46996416-46996438 GCCTCAGCCTCCCGTCTAGCTGG + Intronic
1082012802 11:47461730-47461752 GCCGCAGCCTCCCGAGTGGCTGG + Intergenic
1085057718 11:73416829-73416851 TCCGCAGCCTCCCATGTAGCTGG - Intronic
1085188543 11:74597573-74597595 TCCTCAGCCTCCCGACTAGCTGG + Intronic
1095243766 12:39893412-39893434 GCCTCAGCCTCCCGACTGGCTGG + Intronic
1096297091 12:50393039-50393061 GCCTCAGCCTCCCGAGTGGGTGG + Intronic
1096856645 12:54488399-54488421 CCGGCAGCCACCCGTCCGGGAGG - Intergenic
1098247309 12:68533777-68533799 GCCTCAGCCTCCCGAGTGGGTGG + Intergenic
1098277000 12:68822853-68822875 TCCTCAGCCTCCCGAGTAGGTGG + Intronic
1100577594 12:95907596-95907618 CCGGCAGCCACCCGTCCGGGAGG - Intronic
1100595483 12:96068247-96068269 TCCTCAGCCTCCCGAGTAGGTGG + Intergenic
1101127032 12:101646522-101646544 GCCTCAGCCTCCCGTGTGGCCGG - Intronic
1102152589 12:110699011-110699033 GCCTCAGCCTCCCGACTGGCTGG - Intronic
1102570097 12:113822300-113822322 GACGCAGCCTCCCGCCTGGAAGG - Intronic
1103370181 12:120413560-120413582 TCCTCAGCCTCCCGAGTAGGTGG - Intergenic
1103750260 12:123153648-123153670 GCCTCAGCCTCCCGTGTAGGTGG - Intronic
1104855806 12:131902039-131902061 TCTGCAGCCTCCCGCCTGCTGGG - Intronic
1105900110 13:24746166-24746188 ACCGCAGCCGCCCGTCGCGGTGG + Intergenic
1106267665 13:28124598-28124620 TCCTCAGCCTCCCGAGTAGGTGG - Intergenic
1107305411 13:39013501-39013523 TCCTCAGCCTCCCTTTTGCGTGG - Exonic
1110629412 13:77690472-77690494 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
1113653384 13:112053807-112053829 CCCACAGCCGGCCGTCTGGGTGG - Intergenic
1113963886 13:114140834-114140856 TCCACAGCCTTCCTTGTGGGTGG - Intergenic
1114269194 14:21090940-21090962 TCCGCAGCCTGCGACCTGGGTGG - Exonic
1114507929 14:23232523-23232545 CCAGCAGCCACCCCTCTGGGAGG + Intronic
1116144062 14:41041032-41041054 TCCTCAGCCTCCCGTGTAGCTGG + Intergenic
1118644714 14:67826795-67826817 ACCGCAGCCTCCCGAGTGGCTGG + Intronic
1121656106 14:95597044-95597066 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
1122638747 14:103144289-103144311 CCCTCAGCATCCCTTCTGGGTGG - Intergenic
1123043100 14:105498609-105498631 TCCACAGCCTCCAGCCTGCGTGG - Exonic
1124561935 15:30782303-30782325 GCCTCAGCCTCCCGAGTGGGTGG + Intergenic
1124890498 15:33727626-33727648 GCCGCAGCCTGCAGTCTGGAAGG + Intronic
1127023810 15:54781332-54781354 CCGGCAGCTGCCCGTCTGGGAGG - Intergenic
1128030721 15:64477741-64477763 ACCTCAGCCTCCCGACTGGCTGG + Intronic
1129305633 15:74659345-74659367 TCCCCAGCCTCCCGTGTAGCTGG - Intronic
1129540984 15:76346793-76346815 CGCGCAGGCTCCCGGCTGGGTGG + Intergenic
1129594635 15:76952733-76952755 GCCTCAGCCTCCCGACTAGGTGG + Intronic
1129710116 15:77816600-77816622 ACCCCAGCCTCCTGACTGGGAGG - Intronic
1130682100 15:86005972-86005994 GCCTCAGCCTCCCGTGTAGGTGG + Intergenic
1131261801 15:90891509-90891531 TCAGCAGCCTCCATTCTGAGGGG - Intronic
1132248271 15:100314783-100314805 TCCCCAGCCTCCTGTCTTTGTGG - Intronic
1132387361 15:101409895-101409917 TCCTCAGCCTGCATTCTGGGAGG + Intronic
1132767924 16:1544130-1544152 GCCTCAGCCTCCCGTGTAGGTGG + Intronic
1133746041 16:8687409-8687431 GCCTCAGCCTCCCGTGTGGCTGG - Intronic
1134358779 16:13510191-13510213 TCCTCAGCCTCCCGTGTAGCTGG - Intergenic
1134766577 16:16764105-16764127 TCCGCAGCCTCCCGAGTAGCTGG + Intergenic
1136243567 16:28959686-28959708 TCCTCAGCCTCCCGTGTAGCTGG + Intronic
1136684443 16:31985961-31985983 TCCCCAGCCTCCCGAGTGGCTGG - Intergenic
1136785070 16:32929504-32929526 TCCCCAGCCTCCCGAGTGGCTGG - Intergenic
1136884713 16:33924300-33924322 TCCCCAGCCTCCCGAGTGGCTGG + Intergenic
1138244109 16:55453672-55453694 TCCTCAGCCTCCCATGTAGGTGG - Intronic
1139580361 16:67869668-67869690 GCCGCAGCCTCCCGTGTAGATGG - Intronic
1140473383 16:75226943-75226965 TCCCCAAGCTGCCGTCTGGGTGG - Intergenic
1140499177 16:75418419-75418441 GCCTCAGCCTCCCGTGTAGGTGG + Intronic
1140774854 16:78240227-78240249 TCCGCAGCCTCCCGAGTAGCTGG - Intronic
1141426264 16:83946572-83946594 TCCGCAGCCTCACCCCTGTGCGG + Intronic
1141529494 16:84636438-84636460 GCCTCAGCCTCCCGTGTAGGTGG + Intergenic
1203087730 16_KI270728v1_random:1193513-1193535 TCCCCAGCCTCCCGAGTGGCTGG - Intergenic
1142573489 17:891187-891209 TCCTCAGCCTCCCGAATGGCTGG + Intronic
1143109545 17:4545503-4545525 GCCGCAGGCTCCCGGCAGGGAGG + Intronic
1143442090 17:6982848-6982870 TCCGCAGCCTCCCGAGTAGCCGG - Intronic
1143631594 17:8143282-8143304 TCAGCAGCCTCCGCACTGGGAGG + Exonic
1143716471 17:8775025-8775047 GCCTCAGCCTCCCGACTAGGTGG + Intergenic
1144576019 17:16429977-16429999 GCCTCAGCCTCCCGTATGGCTGG + Intronic
1145863701 17:28227240-28227262 GCCGCAGCCTCCCGCCGTGGAGG + Intergenic
1146078198 17:29753243-29753265 TCCTCAGCCTCCCGAGTAGGTGG + Intronic
1146260184 17:31415822-31415844 TCCGCAGCCTCCCAGCTGGCTGG + Intronic
1147145377 17:38481642-38481664 TCCCCAGCCTCCCGAGTGGCTGG - Intronic
1147189944 17:38732520-38732542 TCCTCAGCCTCCAGTATGGCTGG - Intronic
1148609640 17:48956111-48956133 GCCGCAGCCTCCCGAGTAGGTGG + Intergenic
1148767946 17:50050168-50050190 TCCGCAGCCTCCCGAGTAGCTGG - Intergenic
1149659762 17:58328067-58328089 TCTGCAGCCTCCTTTGTGGGTGG - Exonic
1150239966 17:63622982-63623004 TCGGCAGCCCTCCTTCTGGGCGG + Intronic
1150643825 17:66965911-66965933 TCCGCAGCCTCCCTGCTGAGGGG - Intronic
1151501791 17:74494744-74494766 TCCTCAGCCTCCTGACTGGCTGG + Intergenic
1152821305 17:82439198-82439220 TCGGCTGCCTCCTGTCTGGCTGG - Intronic
1203164308 17_GL000205v2_random:79855-79877 CCTGGAGCCTCCCCTCTGGGGGG - Intergenic
1153249497 18:3107230-3107252 GCCTCAGCCTCCCGAGTGGGTGG + Intronic
1154373840 18:13792263-13792285 GCCTCAGCCTCCCGAGTGGGTGG + Intergenic
1154492607 18:14933311-14933333 TCTGCAGCCTCCTCTCTAGGAGG - Intergenic
1155720246 18:29002257-29002279 ACCTCAGCCTCCCGACTGGCTGG - Intergenic
1156805915 18:41181515-41181537 CCCTCAGCCTTCCTTCTGGGTGG - Intergenic
1158819878 18:61147127-61147149 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
1158870307 18:61680519-61680541 ACCTCAGCCTCCCTACTGGGTGG + Intergenic
1158998287 18:62946378-62946400 GCCGCAGCCTCCCGACTAGCTGG + Intronic
1160697084 19:489874-489896 GCCGCAGCCTCCTGGCTGGGAGG - Intronic
1160769361 19:823325-823347 GCCTCAGCCTCCCATCTGGCTGG - Intergenic
1160984799 19:1833609-1833631 TCCGCAGCCCTCCCCCTGGGTGG - Intronic
1161314942 19:3613351-3613373 TCCTCAGGCTCCAGGCTGGGAGG + Exonic
1161822892 19:6541824-6541846 GCCTCAGCCTCCCGAGTGGGTGG - Intergenic
1162654459 19:12117854-12117876 CCCGCAACCTCGCGTCTGTGCGG + Intronic
1162766454 19:12922749-12922771 CACGCAGCCTCCTGTGTGGGAGG + Exonic
1163042663 19:14614161-14614183 TCCGCAGCCTGCTGAGTGGGTGG + Intergenic
1163698256 19:18774780-18774802 TCAGCCTCCTGCCGTCTGGGAGG + Intronic
1165361792 19:35341347-35341369 TCCGGACCCTCACGTCTCGGGGG - Exonic
1167086246 19:47311677-47311699 GCCTCAGCCTCCCGACTAGGTGG + Intronic
1167443421 19:49523451-49523473 TCCACAGCCTCCCGAGTGGCTGG - Intronic
1168271328 19:55251382-55251404 ACGGCAGCCTCCTGCCTGGGAGG - Intronic
1168277044 19:55284271-55284293 TCCGCGGCCCGCCGACTGGGGGG + Exonic
925617913 2:5761637-5761659 TCCTCAGCCTCCCGTGTAGCTGG + Intergenic
926730538 2:16032766-16032788 TCCGCAGCGCCCCTTCAGGGTGG + Intergenic
928509068 2:31984689-31984711 GCCTCAGCCTCCCGACTGGCTGG - Intronic
928554229 2:32406279-32406301 GCCTCAGCCTCCCGTGTAGGTGG - Intronic
930344707 2:50165461-50165483 GCCTCAGCCTCCCGACTAGGTGG + Intronic
931265686 2:60658164-60658186 TCCTCAGCCTCCCATCTGCTGGG + Intergenic
935251899 2:101270183-101270205 TCTGCACCCTCCTGTCTGGGTGG + Exonic
936477461 2:112851779-112851801 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
936711937 2:115141886-115141908 GCCTCAGCCTCCCGTGTAGGGGG + Intronic
936790476 2:116144999-116145021 TCCTCAGCCTCCCCTGTGGCTGG - Intergenic
937418845 2:121738315-121738337 TCCTCAGCCTCCCGACTAGCTGG + Intronic
937754424 2:125518433-125518455 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
938050346 2:128164062-128164084 ACCTCAGCCTCCCGACTGGCTGG - Intronic
942562602 2:177236234-177236256 TGCGCTGCCTCCAGGCTGGGTGG - Intronic
945737408 2:213617454-213617476 GCCTCAGCCTCCCGACTGGCTGG + Intronic
946447339 2:219751191-219751213 CCTGCAGCCGCCCGTCCGGGAGG - Intergenic
1168974059 20:1950993-1951015 TCCGCCGCCTTCCCTCTGAGAGG - Intergenic
1170356225 20:15495096-15495118 TCTGTAGCCTCCCCTCCGGGTGG + Intronic
1171465301 20:25323809-25323831 TCCCCAGCCTCCCTCCTGGCTGG - Intronic
1171989171 20:31682558-31682580 GCCTCAGCCTCCCGACTAGGTGG + Intronic
1172549852 20:35790313-35790335 TCCTCAGCCTCCCCTGTAGGTGG + Intronic
1174043395 20:47715694-47715716 GCCTCAGCCTCCCGACTGGCTGG + Intronic
1174552096 20:51369440-51369462 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
1174644726 20:52075971-52075993 GCCTCAGCCTCCCGTGTGGCTGG + Intronic
1175239457 20:57536123-57536145 TCCCCCACCTCCCCTCTGGGCGG - Intergenic
1175838316 20:62010617-62010639 GCCGCAGCCTCCCATAGGGGAGG + Intronic
1175875604 20:62227928-62227950 CCCCCTGCCTCCCGCCTGGGTGG + Intergenic
1176145717 20:63564556-63564578 TCCTCAGCCTCCTGCCTGGCCGG - Exonic
1176337301 21:5610945-5610967 CCTGGAGCCTCCCCTCTGGGGGG + Intergenic
1176470963 21:7106171-7106193 CCTGGAGCCTCCCCTCTGGGGGG + Intergenic
1176494524 21:7487949-7487971 CCTGGAGCCTCCCCTCTGGGGGG + Intergenic
1176506118 21:7650434-7650456 CCTGGAGCCTCCCCTCTGGGGGG - Intergenic
1177635749 21:23784705-23784727 GCCTCAGCCTCCCGACTAGGTGG - Intergenic
1178865037 21:36320212-36320234 TCCGCCGCAACCCGACTGGGAGG - Exonic
1180092904 21:45542044-45542066 TCTGCAGCCTGGGGTCTGGGGGG - Intronic
1180092929 21:45542104-45542126 TCTGCAGCCTGGGGTCTGGGGGG - Intronic
1180757954 22:18176165-18176187 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1180768242 22:18359958-18359980 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
1180778067 22:18502432-18502454 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1180810791 22:18759743-18759765 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1181196940 22:21193998-21194020 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1181739674 22:24910828-24910850 GCCGCAGCCTCCCGTGTAGCTGG - Intronic
1182336327 22:29585881-29585903 ACCTCAGCCTCCCGTCTAGCTGG + Intergenic
1182564025 22:31184228-31184250 CCCACCGCCACCCGTCTGGGAGG - Intronic
1183351289 22:37336133-37336155 TCCCCAGGATCCCGTTTGGGAGG + Intergenic
1184440985 22:44514972-44514994 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
1184771844 22:46601679-46601701 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1203229860 22_KI270731v1_random:100845-100867 TCCTCAGCCTCCCGAGTGGCTGG - Intergenic
951576127 3:24116015-24116037 GCCTCAGCCTCCCGTGTGGCTGG + Intergenic
953307078 3:41841094-41841116 CCAGCCGCCACCCGTCTGGGAGG + Intronic
953948985 3:47173485-47173507 TCCTCAGCCTCCCGACTAGCTGG - Intergenic
954843584 3:53534469-53534491 TCCGCATCTTCCTGCCTGGGAGG + Intronic
956328134 3:68075809-68075831 TCCTCAGCCTCCCTACTGGCTGG + Intronic
959184718 3:103032016-103032038 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
959703084 3:109316398-109316420 TCCGCAGCCTTCGGAGTGGGTGG + Exonic
960781954 3:121329743-121329765 GCCTCAGCCTCCCGTGTAGGTGG - Intronic
961704688 3:128774893-128774915 GCCTCAGCCTCCCGTATGGCTGG + Intronic
961784486 3:129339954-129339976 CCAGCAGCCACCCGTCCGGGAGG - Intergenic
963733083 3:148991452-148991474 TCCGCATCCTCCCAGCTGCGCGG - Exonic
965881635 3:173395556-173395578 TCCGACGCCTCGCGTCTGGGCGG + Intergenic
968422546 4:497781-497803 ACCGCAGCCTCCCGTGTAGCTGG - Intronic
968571934 4:1346681-1346703 CCCGCGCCCGCCCGTCTGGGCGG + Intergenic
968672026 4:1856897-1856919 ACCGCGTCCTCCCGTCTGAGCGG + Intergenic
969407768 4:7005582-7005604 TCCTCAGCCTCCCGAGTAGGTGG - Intronic
973313386 4:48733158-48733180 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
975908911 4:79245778-79245800 CGCCCAGCCGCCCGTCTGGGGGG + Intronic
976535995 4:86218293-86218315 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
976816026 4:89148975-89148997 TCCGCAGCCTGCCATCCTGGGGG - Intergenic
978521366 4:109619188-109619210 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
979474593 4:121140217-121140239 GCCTCAGCCTCCCGACTGGCTGG - Intronic
980428240 4:132655063-132655085 GCCTCAGCCTCCCGTGTGGCTGG - Intergenic
982561629 4:156935110-156935132 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
984636015 4:182110437-182110459 TCCTCAGCCTCCCGAGTAGGTGG + Intergenic
986198675 5:5561345-5561367 TATGCAGCCTCCCTTCTGGGTGG + Intergenic
987109359 5:14670717-14670739 TCCTCAGCCTCCTTTCTAGGGGG + Intronic
987146006 5:14992432-14992454 GCCTCAGCCTCCCGACTAGGTGG + Intergenic
989211567 5:38862435-38862457 CCAGCAGCCACCCGTCCGGGAGG - Intronic
989216629 5:38910893-38910915 GCCTCAGCCTCCCGACTGGCTGG - Intronic
991082822 5:62619736-62619758 GCCTCAGCCTCCCGACTAGGTGG - Intronic
991394080 5:66185254-66185276 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
994126565 5:96173853-96173875 GCCTCAGCCTCCCGACTAGGTGG + Intergenic
994757473 5:103812660-103812682 TCCTCAGCCTCCCGTGTAGCTGG + Intergenic
997282208 5:132656334-132656356 TCCGCAGCTTCCAGACTGGCCGG + Intronic
998931596 5:147187462-147187484 TCTGCAGCCTCCCCTGGGGGTGG + Intergenic
999528978 5:152440969-152440991 GCCTCAGCCTCCCGACTGGCTGG + Intergenic
1000065265 5:157688703-157688725 GCCTCAGCCTCCCGTGTGGCTGG - Intergenic
1002382946 5:178843264-178843286 GCCTCAGCCTCCCGAGTGGGTGG - Intergenic
1003950507 6:11111424-11111446 TCATCAGCCTCCTGTCTGGGGGG + Intronic
1004202743 6:13564742-13564764 ACCTCAGCCTCCCGTATGGCTGG + Intergenic
1007586392 6:42992706-42992728 GCCTCAGCCTCCCGTGTGGCTGG - Intronic
1007887177 6:45243077-45243099 ACCGCAGCCTCCCGACTAGCTGG - Intronic
1010136298 6:72557478-72557500 TCCACTGCCTTCCTTCTGGGAGG - Intergenic
1010885927 6:81240392-81240414 TCCTCAGCCTCCCGAGTAGGTGG - Intergenic
1010913644 6:81589028-81589050 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1012130598 6:95486957-95486979 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1016188205 6:141224000-141224022 TCCTCAGCCTCCCGTGTAGCTGG - Intergenic
1019423751 7:963564-963586 CCCCCAGCCTCCCCTCTGAGTGG + Intronic
1019672395 7:2288227-2288249 TCCTCAGCCTCCCGAGTAGGTGG - Intronic
1019917783 7:4144537-4144559 TCCCCAGCCCGCCATCTGGGAGG - Intronic
1020185279 7:5954251-5954273 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
1020297634 7:6770494-6770516 TCCTCAGCCTCCCGAGTGGCTGG - Intronic
1020604246 7:10316024-10316046 CCCTCAGCATCCCTTCTGGGTGG + Intergenic
1021055022 7:16036299-16036321 GCCTCAGCCTCCCGACTGAGGGG - Intergenic
1025085723 7:56021833-56021855 GCCTCAGCCTCCCGAGTGGGTGG - Intronic
1025225100 7:57151418-57151440 GCCTCAGCCTCCCGTGTGGCTGG + Intergenic
1025800919 7:64785102-64785124 GGGTCAGCCTCCCGTCTGGGAGG + Intergenic
1026036288 7:66832698-66832720 CCAGCAGCCTCCCCTCTGGGGGG - Intergenic
1026983202 7:74538440-74538462 CCAGCAGCCTCCCCTCTGGGGGG + Intronic
1027214312 7:76174044-76174066 CCAGCAGCCTCCCCTCTAGGGGG + Intergenic
1028621935 7:92835407-92835429 GCCGAAGCCGACCGTCTGGGGGG - Intronic
1034234374 7:149555243-149555265 CCGCCAGCCGCCCGTCTGGGAGG + Intergenic
1034410352 7:150937949-150937971 TCCTCAGCATCCCCTGTGGGTGG - Intergenic
1035200588 7:157262531-157262553 GCCGCAGCCTCCCGAGTAGGTGG + Intronic
1036609733 8:10339654-10339676 GCCTCAGCCTCCCGACTAGGTGG + Intronic
1038237661 8:25776338-25776360 GCAGCAGCCTTCCCTCTGGGAGG + Intergenic
1039067862 8:33624590-33624612 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
1039707747 8:40024532-40024554 ACCTCAGCCTCCCGACTGGCTGG - Intergenic
1040788896 8:51201681-51201703 TCCTCAGCCTCCCGAGTAGGTGG - Intergenic
1044346200 8:91107247-91107269 TCCTCAGCCTCCCGAGTGGCTGG + Intronic
1047457472 8:125029144-125029166 GCCTCAGCCTCCCGACTGGCTGG + Intronic
1048010182 8:130449126-130449148 ACAGCAGCCTCCCCTCGGGGAGG + Intergenic
1049063981 8:140298535-140298557 GCCTCAGCCTCCCGAGTGGGTGG - Intronic
1049658393 8:143808920-143808942 GCCGCTGCCTCCCGCCTGGCAGG + Exonic
1049725826 8:144145565-144145587 GCCTCAGCCTCCCGACTGGCTGG - Intergenic
1053157801 9:35792316-35792338 TCCCCAGGCTCCAGGCTGGGGGG + Exonic
1058872078 9:109211343-109211365 TCCGCAGCCTCCCAAATGGCTGG - Intronic
1059454683 9:114392373-114392395 TCTGCAGCCTCCTGTCTGCATGG - Intronic
1060634361 9:125188667-125188689 GCCTCAGCCTCCCGACTAGGTGG - Intronic
1061329309 9:129882146-129882168 TCTGGAGCCGCCTGTCTGGGTGG - Intergenic
1062333862 9:136056430-136056452 CCCGCTGCCTCCCGACTGTGAGG - Intronic
1203424360 Un_GL000195v1:23961-23983 CCTGGAGCCTCCCCTCTGGGGGG - Intergenic
1185832025 X:3311347-3311369 TCACCAGACTCCCGTCTGGGAGG + Exonic
1187844655 X:23523380-23523402 CCAGCTGCCACCCGTCTGGGAGG + Intergenic
1189342381 X:40214040-40214062 TCCTCAGCCTCCCGTGTAGCTGG + Intergenic
1189659958 X:43286265-43286287 TGCCCAGCCTCCCTTCTTGGTGG + Intergenic
1189914869 X:45847166-45847188 ACCTCAGCCTCCCGACTGTGTGG + Intergenic
1190650004 X:52559714-52559736 ACCTCAGCCTCCCGATTGGGTGG - Intergenic
1190725076 X:53184352-53184374 TCCTCAGCCTCCCGTGTAGCTGG + Intergenic
1190796226 X:53745855-53745877 TCCTCAGCCTCCCGAGTGGCTGG + Intergenic
1192805467 X:74504873-74504895 ACCTCAGCCTCCCGTGTGGCTGG - Intronic
1195469794 X:105219182-105219204 TCAGCTGCCTTCCGACTGGGAGG - Exonic
1196354760 X:114777670-114777692 TCCGCAGCCTCCCGAGTAGCTGG + Intronic
1197777689 X:130130068-130130090 TCCACAGGCTCCCGTCCAGGGGG - Exonic
1199215269 X:145254609-145254631 ACCGCAGCCTCCCTTCTCAGGGG - Intronic