ID: 1081812862

View in Genome Browser
Species Human (GRCh38)
Location 11:45923051-45923073
Sequence CTCCGCAGCCTCCCGTCTGG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 136}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812862_1081812876 16 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812862_1081812878 18 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812862_1081812869 4 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812862_1081812871 5 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812862_1081812866 -5 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812862_1081812872 6 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812862_1081812875 10 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812862_1081812868 3 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812862_1081812877 17 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812877 11:45923091-45923113 GAGACCCGGGGGCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 317

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812862 Original CRISPR CTCCGCAGCCTCCCGTCTGG GGG (reversed) Exonic
901199394 1:7458047-7458069 CTCACCAGCTTCCTGTCTGGGGG + Intronic
903356957 1:22754226-22754248 CTCAGAAACCTCCCGTCTTGTGG + Intronic
906055743 1:42915451-42915473 GTCTGCAGCCTCCCACCTGGGGG + Intergenic
906319980 1:44809764-44809786 CCCCACACCCTCCTGTCTGGAGG + Intronic
906512087 1:46415805-46415827 CTCTGCAGCCTCGTGTCTGAAGG - Intergenic
907526367 1:55056352-55056374 CTCCCCAGCCTCCCGCATGGCGG - Intronic
908128249 1:61050836-61050858 CTCCGCGGCCTCCCGCCCGGGGG - Intronic
908648526 1:66306477-66306499 CTCCGGAGCCTGCCAACTGGTGG + Intronic
914836424 1:151210658-151210680 CACTGCAGCCTCCCGTCTCCTGG + Intronic
915074302 1:153296219-153296241 CTCCGCAGCCTGCTACCTGGAGG + Intergenic
915340176 1:155173076-155173098 CCCCGAACCCTCCCGTCCGGTGG + Intronic
918044464 1:180933400-180933422 CTCCACTGCCTCCTGTCTGTAGG - Intronic
920234565 1:204494284-204494306 CTCGGCTGCCTCCACTCTGGGGG + Intronic
920442220 1:205988922-205988944 CTTCCCAGCCTCCCCTCTTGGGG + Intronic
924627372 1:245706782-245706804 CTGCCCAGACTCCCGTGTGGTGG - Intronic
1066386423 10:34945245-34945267 CTCTGAAGCCTCCCACCTGGAGG - Intergenic
1067438884 10:46297096-46297118 CTTGGCAGCCTCTCCTCTGGAGG + Intronic
1067487821 10:46668502-46668524 CTCCCCAGCCAGCCTTCTGGAGG + Intergenic
1067790324 10:49282979-49283001 CTCCCCACCCTCCCGGATGGCGG - Intergenic
1069777372 10:70934865-70934887 CTCCCCAGCCTGCCTGCTGGAGG - Intergenic
1069779675 10:70946788-70946810 CTTTGCAGCCTCCTGTCTTGAGG - Intergenic
1074395765 10:113096833-113096855 ATCCCCACCCTCCCCTCTGGAGG - Intronic
1074824020 10:117201905-117201927 ATCCCCAGCTTCCCTTCTGGTGG + Intronic
1077058820 11:608919-608941 CTCCGCTTCCTCCGGTCTCGGGG - Exonic
1077420358 11:2447108-2447130 CACTGCAGCCACCCGTGTGGAGG + Intronic
1081735481 11:45400576-45400598 CTCAGCAGCCGCCTGTCAGGCGG + Intergenic
1081812862 11:45923051-45923073 CTCCGCAGCCTCCCGTCTGGGGG - Exonic
1082877313 11:58001402-58001424 CTCTGCAGCCTTCTGCCTGGAGG + Intergenic
1083254324 11:61486910-61486932 CACCTCAGCCTCCCTTCTGGTGG + Intronic
1083292079 11:61696005-61696027 CTCCGCAGGCTGCCGTCTTTGGG - Intronic
1083827559 11:65212014-65212036 CTCCCCAGCCTACTGCCTGGAGG + Intergenic
1084161968 11:67355019-67355041 CTCCTCTGCCTCCCCTCTGGTGG - Intronic
1084675628 11:70632371-70632393 CGCCTCAGCCTCCCAACTGGCGG + Intronic
1089768577 11:120786181-120786203 CTCAGCCGCCTCCCTTCCGGTGG + Intronic
1090862576 11:130666954-130666976 AGCCGCAGCCTGCCATCTGGAGG + Intergenic
1102571703 12:113830755-113830777 CTCCTCTGCCTCAGGTCTGGAGG + Intronic
1103797750 12:123516505-123516527 CTCCACTCCCTCCCCTCTGGGGG + Intronic
1104355367 12:128080496-128080518 CTCTGAAGCCTGCTGTCTGGAGG + Intergenic
1104671548 12:130684065-130684087 CTCTGAAGCCTGCTGTCTGGAGG + Intronic
1104855807 12:131902040-131902062 CTCTGCAGCCTCCCGCCTGCTGG - Intronic
1105247436 13:18666093-18666115 CACAGCAGCTTCCCGGCTGGTGG - Intergenic
1105975509 13:25468908-25468930 GCTCGCAGCCTCCCGCCTGGCGG + Intronic
1110436557 13:75482474-75482496 CTACTCCGCCTCCCGTCCGGCGG + Intergenic
1113953077 13:114082613-114082635 CCCAGCTGCGTCCCGTCTGGGGG + Intronic
1117954278 14:61110818-61110840 CTCAGAAGCCTCCTGGCTGGTGG + Intergenic
1122715648 14:103695509-103695531 CTCCGGAGCTTCCCTTGTGGTGG + Intergenic
1122971378 14:105153600-105153622 CTCCGCAGCATCCGGTGGGGGGG + Intronic
1124399772 15:29338097-29338119 CTCTGCAGTCTCCTGTCTGCAGG - Intronic
1124687470 15:31794710-31794732 CCCCCCAGCCCACCGTCTGGGGG + Intronic
1125509048 15:40283083-40283105 CTCCGCCTCCTCCCCTCTCGCGG + Intronic
1127320560 15:57841048-57841070 CTCAGCAGCCACATGTCTGGGGG - Intergenic
1131095165 15:89649927-89649949 CTCCCCAGCCTCCCTCCTTGAGG - Exonic
1131905046 15:97133883-97133905 CTCCTCAGCCTCCTGTCATGAGG - Intergenic
1132011075 15:98277160-98277182 CTCTGCAGCCTCCCAGATGGTGG + Intergenic
1132575049 16:660339-660361 CACCACAGAGTCCCGTCTGGAGG - Intronic
1132675871 16:1121043-1121065 CACCTCAGCCTCCCGGCTTGTGG + Intergenic
1133325110 16:4937324-4937346 CTCCGGAGTCCCCCGGCTGGGGG - Intronic
1135305173 16:21361797-21361819 CTCTGCAGCTTCCCGTCTCCCGG + Intergenic
1136995052 16:35183371-35183393 CTCAGCTGCCTCCCATCTGGAGG - Intergenic
1141664091 16:85456992-85457014 TTCCGCAGCCTCCTTTCTGGGGG + Intergenic
1142141893 16:88476233-88476255 CTGCACAGCCTCCCTGCTGGGGG + Intronic
1144488011 17:15683838-15683860 CTCTGCAGCCTGCAGTGTGGTGG - Intronic
1147315402 17:39617912-39617934 CCCCGCGGCCTCCCGCTTGGGGG + Intergenic
1150267155 17:63838958-63838980 CTCCCCATCCTCACGTCTGTGGG - Intronic
1150490831 17:65573244-65573266 CTCAGCAGCCCCCAGTCTGGGGG + Intronic
1150643826 17:66965912-66965934 CTCCGCAGCCTCCCTGCTGAGGG - Intronic
1152753293 17:82076524-82076546 CCCCGTAGCCTCCTGCCTGGCGG + Intergenic
1152830831 17:82496154-82496176 ATCGGCAGCCCCCAGTCTGGAGG - Intergenic
1159241639 18:65750539-65750561 CTCCTCCACCTCCCGCCTGGCGG - Intronic
1161069369 19:2252698-2252720 CTCTGCAGCCTCCCGACTCCCGG + Exonic
1161095476 19:2387933-2387955 CCCACCAGCATCCCGTCTGGAGG - Intergenic
1161531531 19:4792726-4792748 CACGGCAGCTTCCCGGCTGGTGG - Exonic
1161800969 19:6416603-6416625 CTACGAAGGCTCCCGTCTGCTGG + Exonic
1163830021 19:19543174-19543196 CTCCCCAGCCTGCAGACTGGGGG + Intronic
1165012543 19:32859357-32859379 CTCAGCAGCCCCCAGTCTTGTGG + Intronic
1165415644 19:35691803-35691825 CACCTCAGCCTCCCGACTAGCGG - Intergenic
1165672621 19:37692378-37692400 CGCAGCCGCCTCCCGACTGGAGG + Intronic
1165830649 19:38728740-38728762 CTCTGCACCCTCCCCTCTCGTGG - Intronic
1166614804 19:44233780-44233802 CTCCTCAGCCTCCCGGGTAGCGG - Intronic
1166694499 19:44844937-44844959 CACCGCAGCCACCCGCCAGGGGG - Intergenic
1168120618 19:54250855-54250877 CTCAGTTGCCTCCCGTCTGAGGG + Exonic
1168177791 19:54636787-54636809 CTCAGTTGCCTCCCGTCTGAGGG - Exonic
1168186617 19:54704435-54704457 CTCCACTGCTTCCTGTCTGGAGG + Intergenic
1168277043 19:55284270-55284292 CTCCGCGGCCCGCCGACTGGGGG + Exonic
930029849 2:47051765-47051787 CATCGCCGCCTCCCGGCTGGAGG + Exonic
931265685 2:60658163-60658185 CTCCTCAGCCTCCCATCTGCTGG + Intergenic
948700624 2:239757509-239757531 CTGAGCAGCCTCTCGTGTGGTGG - Intergenic
949031955 2:241801584-241801606 CTCCACAACCTCCCAGCTGGTGG - Intronic
1168820332 20:768718-768740 CTCTGCCCCCTCCCTTCTGGGGG + Intergenic
1170039170 20:12022332-12022354 CTCCCCTGCCTCCCATCTGTAGG + Intergenic
1172620768 20:36316821-36316843 CTCCCCAGCCTCTTCTCTGGGGG + Intronic
1173165042 20:40682259-40682281 CTCTGCAGCCTGCAGTCTGCTGG - Intergenic
1173646958 20:44639340-44639362 CCCCGCATCCTCCCTCCTGGAGG - Intronic
1178715873 21:34963818-34963840 CTCGAAAGCCTCCCTTCTGGAGG - Intronic
1179788748 21:43743613-43743635 CTCCCCAGCCACCCCTCTGCAGG + Intronic
1182709485 22:32311657-32311679 CTGGGGAGCCTCCCATCTGGTGG - Intergenic
1184462787 22:44648775-44648797 GTCCCCAGCCTCCAGCCTGGGGG + Intergenic
1185305428 22:50112767-50112789 CTCCGCAGCTTCTCCTGTGGGGG + Intronic
1185361520 22:50410598-50410620 TGCCTCAGCCTCCCGTCTGGGGG + Intronic
950626629 3:14252302-14252324 CTCTGCAGCCTCACTTCTGTGGG + Intergenic
952963378 3:38606571-38606593 CCCAGCAGCCTCCCCACTGGTGG - Intronic
954579857 3:51697336-51697358 CTCCCTAGCTTCCCTTCTGGAGG - Intronic
955769249 3:62372553-62372575 CTCCGCCGCCGCCCGCCCGGAGG + Exonic
962279023 3:134036336-134036358 CTCAGCAGCCTCCTCCCTGGGGG + Intronic
968959486 4:3735652-3735674 CTCCACAGCGTCCAGGCTGGGGG + Intergenic
974935327 4:68404309-68404331 CTCTGAAGCCTCCCATCTGGAGG + Intergenic
975908910 4:79245777-79245799 CCGCCCAGCCGCCCGTCTGGGGG + Intronic
976350430 4:84054320-84054342 CTCCTCAGCCAACCTTCTGGAGG + Intergenic
977053355 4:92158517-92158539 CACCTCAGCCTCCCGAGTGGCGG + Intergenic
977317040 4:95463218-95463240 CCCCGCAGCCACCCGTCTGCGGG - Intronic
977814616 4:101400342-101400364 CTCCTCAGCCTCCCTTCAGGGGG - Intergenic
978551128 4:109928482-109928504 CTCTGAAGCCTGCTGTCTGGAGG - Intronic
980736708 4:136899689-136899711 CTCTGAAGCCTGCCATCTGGAGG - Intergenic
983904519 4:173169467-173169489 TCCCGCAGCCGCCCGTCTGGGGG + Intronic
987109358 5:14670716-14670738 CTCCTCAGCCTCCTTTCTAGGGG + Intronic
991916371 5:71610037-71610059 CTCTGTAGGCTCCCCTCTGGGGG - Intronic
992108028 5:73466466-73466488 CTCTGAAGCCTGCCATCTGGAGG - Intergenic
996711831 5:126551280-126551302 CTCCGCAGCCTGTCCTCTGCTGG + Intronic
997646758 5:135487195-135487217 CTCAGCAGCCTCCCTGATGGGGG + Intergenic
997672426 5:135686498-135686520 CTCCGCTGCTCCCCGTATGGTGG + Intergenic
1001844488 5:174909986-174910008 CTCTCCAGCCTCCCGACTGATGG - Intergenic
1003306742 6:4935896-4935918 CTCTGCTCCCTCCCTTCTGGTGG - Intronic
1003950506 6:11111423-11111445 CTCATCAGCCTCCTGTCTGGGGG + Intronic
1006387405 6:33739008-33739030 CCCCACAGCCTCCTGGCTGGGGG + Intronic
1006426014 6:33963447-33963469 CTCCGCAGGGGCCCGTCTGCTGG - Intergenic
1006839516 6:37019482-37019504 CTCTGCTGCCTCCCATGTGGTGG - Intronic
1007269755 6:40627604-40627626 CTCAGCATCGTCCCCTCTGGGGG - Intergenic
1011029800 6:82909483-82909505 CTCTGCAGCATCTCCTCTGGAGG - Intronic
1016330675 6:142948937-142948959 CACCTCAGCCTCCCGAGTGGAGG + Intergenic
1019422261 7:956229-956251 CCCCAAAGCCTCCCGTCTGAGGG - Intronic
1020011555 7:4808240-4808262 CTCCTCACCCTCCTCTCTGGAGG + Intronic
1020033062 7:4946558-4946580 CTCAGCAGCCTCTCACCTGGTGG - Intronic
1021555800 7:21916408-21916430 CGCCGCAGCCTCGCCTCTGTGGG + Intronic
1022435502 7:30380355-30380377 GTCTGCAGCCTCCCTGCTGGAGG - Intronic
1023177672 7:37448982-37449004 CTCCGCAGCGTCCGCTCGGGAGG - Exonic
1026036290 7:66832699-66832721 ACCAGCAGCCTCCCCTCTGGGGG - Intergenic
1026983200 7:74538439-74538461 ACCAGCAGCCTCCCCTCTGGGGG + Intronic
1028621936 7:92835408-92835430 CGCCGAAGCCGACCGTCTGGGGG - Intronic
1029085995 7:98012208-98012230 CACCTCAGCCTCTCATCTGGTGG + Intergenic
1031396444 7:121279919-121279941 CTCTCCAGCCTCCTGTCTGAGGG - Intronic
1033126240 7:138709733-138709755 CTCCCCAGCCTCGCGTCTGAAGG + Exonic
1034456364 7:151173146-151173168 CTCCCCAGCCTCCTGGCTGTTGG - Intronic
1034556682 7:151854775-151854797 CCCCGCTGCCTCCCTTCTTGAGG - Intronic
1036707997 8:11059472-11059494 CTCCGCAGCTGCCTGTCGGGCGG - Intronic
1037819891 8:22130508-22130530 CTCCGGGGCCTCCCGGCCGGCGG + Exonic
1042568267 8:70134580-70134602 CTTCTCAGCCTCACATCTGGCGG + Intronic
1049354941 8:142182881-142182903 CTCTGAAGCCTCCCAGCTGGAGG - Intergenic
1049423045 8:142525265-142525287 CTCTCCTGCCTCCCGCCTGGAGG - Intronic
1051080993 9:13293045-13293067 CTCCAAAGCCTCCGGACTGGTGG + Intergenic
1057195688 9:93114746-93114768 ATCTGCCGCCTCCCGCCTGGTGG + Intergenic
1061954558 9:133955088-133955110 CACCGCTGCCTCCCATCTGCAGG - Intronic
1062139360 9:134947393-134947415 TTCCGCACCCTCCTGGCTGGAGG - Intergenic
1062477484 9:136735987-136736009 CTCCGCAGCGTGCCACCTGGTGG - Intergenic
1189253497 X:39619799-39619821 CTCCCCAGCCTGCTGTCTGATGG - Intergenic