ID: 1081812863

View in Genome Browser
Species Human (GRCh38)
Location 11:45923052-45923074
Sequence TCTCCGCAGCCTCCCGTCTG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 2, 3: 14, 4: 143}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812863_1081812872 5 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812863_1081812868 2 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812863_1081812866 -6 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812863_1081812877 16 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812877 11:45923091-45923113 GAGACCCGGGGGCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 317
1081812863_1081812871 4 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812863_1081812876 15 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812863_1081812875 9 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812863_1081812869 3 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812863_1081812878 17 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812863 Original CRISPR TCTCCGCAGCCTCCCGTCTG GGG (reversed) Exonic
900198487 1:1390153-1390175 TCTCCCCCGCCTCCATTCTGGGG - Intronic
901639276 1:10685239-10685261 TCTCCCCAGACTCCCCTCTAGGG - Intronic
907291769 1:53418511-53418533 TCACTGCAACCTCCCTTCTGAGG - Intergenic
908128250 1:61050837-61050859 TCTCCGCGGCCTCCCGCCCGGGG - Intronic
915599267 1:156912485-156912507 TCTCCCCAGGCTGCCCTCTGGGG + Exonic
917020979 1:170586595-170586617 TCTAAGCAGCCTCCAGGCTGAGG - Intergenic
918271965 1:182910569-182910591 TCTCTTCAGCCCCTCGTCTGAGG - Intronic
920281449 1:204846675-204846697 TCACTGCACCCTCCCGGCTGTGG + Intronic
920696289 1:208183539-208183561 TCTGCGCAGCGTCCCCACTGGGG + Intronic
921049475 1:211500862-211500884 TCTCAGCAGCCACCTCTCTGAGG + Intergenic
1062841098 10:672467-672489 GCTCCCCAGCCTCGCCTCTGGGG - Intronic
1063946088 10:11177847-11177869 TCTCCGCAGCCTCCACCATGGGG - Intronic
1063983660 10:11478259-11478281 TCTCCACAGCCTCAGGTGTGTGG - Intronic
1065204576 10:23344441-23344463 TCGCAGCAGCCTCCAGGCTGTGG - Intronic
1065319270 10:24494077-24494099 ACTCCGCAGCCTCCCAGCTGAGG + Intronic
1065652176 10:27903929-27903951 TCTCCTCTTCCTCCCCTCTGGGG + Intronic
1070097869 10:73355857-73355879 TCCCCGCTGCCCCCAGTCTGTGG + Intronic
1074160731 10:110834426-110834448 TGTCCTCACCCTCCCTTCTGGGG - Intronic
1081805150 11:45886202-45886224 TCTCCCCAACCTCCGGGCTGCGG + Intronic
1081812863 11:45923052-45923074 TCTCCGCAGCCTCCCGTCTGGGG - Exonic
1083292080 11:61696006-61696028 CCTCCGCAGGCTGCCGTCTTTGG - Intronic
1083901012 11:65643486-65643508 TGTCCCCAGCATCCAGTCTGAGG - Intronic
1085157748 11:74311693-74311715 TCTCCGCCCCCTCCCGGCTCAGG + Intergenic
1085282423 11:75339991-75340013 TCTGCTCTGCCTCCCGCCTGAGG - Intronic
1085698131 11:78722857-78722879 TCTCAGCAGCCTCCTGTCATTGG - Exonic
1088647553 11:111928685-111928707 TCACCGCAGCCTCGCCTCTCGGG - Intronic
1090669140 11:128933970-128933992 TCTGAGCAGCCTGCAGTCTGAGG + Intergenic
1090961615 11:131562405-131562427 TCTCCCCACCTTCCCGTCTTGGG - Intronic
1091241869 11:134058447-134058469 GCTACGCTGCCTCCCGCCTGTGG + Intergenic
1091320589 11:134646698-134646720 TCTCTGCAGCCTCCTTTCTTGGG - Intergenic
1092670169 12:10853420-10853442 TCTCTGCAGAGTCCCATCTGAGG - Intronic
1092919527 12:13218699-13218721 TGTCCCCAGCCTCCCGCCTCAGG - Exonic
1098446358 12:70569744-70569766 GCTCCCCGGCCTCCAGTCTGTGG + Exonic
1102106420 12:110327918-110327940 TGTTCGAAGCCTCCCGTCTGTGG + Exonic
1102674768 12:114649998-114650020 TCTCCCCAGCCACCCGGCCGTGG + Intergenic
1104669134 12:130668380-130668402 TCTGTGCAGCCTCCCGTCCCAGG - Intronic
1107878364 13:44810287-44810309 TTTCCACACCCTCCCCTCTGTGG + Intergenic
1108787418 13:53921543-53921565 TCTCCGCACCCTCCCTGCAGCGG + Intergenic
1110245804 13:73323060-73323082 TCTCAGCAGCATCAGGTCTGTGG - Intergenic
1111554468 13:89862214-89862236 TCACCGCAACCTCCCGCCTCTGG - Intergenic
1113907446 13:113826442-113826464 TCTCCCCAGCCTCCCGGCGCCGG + Intronic
1113953075 13:114082612-114082634 TCCCAGCTGCGTCCCGTCTGGGG + Intronic
1119352343 14:73976377-73976399 TCCCCACAGTCTCCTGTCTGTGG + Exonic
1119379158 14:74217843-74217865 TCTCCGAAGTCTCCCGCTTGCGG + Intergenic
1122834567 14:104424483-104424505 CCCATGCAGCCTCCCGTCTGTGG - Intergenic
1122871586 14:104641238-104641260 TCTCCCCAGCCTGCCTTCTCAGG - Intergenic
1122971377 14:105153599-105153621 TCTCCGCAGCATCCGGTGGGGGG + Intronic
1123989104 15:25670089-25670111 TGTCTGCAGCCTCCCTGCTGGGG - Intergenic
1124220691 15:27847542-27847564 TCTCCGTGGCCTCCTGTCTTTGG - Intronic
1124414417 15:29463182-29463204 TCTCTGCAGCCTGCCTCCTGGGG - Intronic
1125536220 15:40442114-40442136 GCTCCGCCGCCTCTCTTCTGGGG + Intronic
1125752067 15:42036178-42036200 TCCCCGCACCCTCCCTGCTGCGG - Intronic
1126252017 15:46578558-46578580 GCTCCTCAGCCTGCCATCTGGGG + Intergenic
1127320561 15:57841049-57841071 TCTCAGCAGCCACATGTCTGGGG - Intergenic
1128258655 15:66216601-66216623 TCTCTGCTGCCTCCCTTCTTTGG - Intronic
1132400973 15:101505076-101505098 TCCCCGTGGCCTCCCGCCTGGGG - Intronic
1132638205 16:963983-964005 GCTCTGCTGCCTCCCGTGTGGGG - Intronic
1132731026 16:1362138-1362160 TCTTCCCGGGCTCCCGTCTGAGG - Intronic
1134514158 16:14873388-14873410 TCTCCGCAGCCACTAGTCTGGGG - Intronic
1134701800 16:16271887-16271909 TCTCCGCAGCCACTAGTCTGGGG - Intronic
1134970030 16:18522763-18522785 TCTCCGCAGCCACTAGTCTGGGG + Intronic
1135205058 16:20476638-20476660 ACTCAGCAGCCTCTCTTCTGAGG + Intronic
1135213839 16:20547175-20547197 ACTCAGCAGCCTCTCTTCTGAGG - Intronic
1137773118 16:51034003-51034025 TCTCCGCAGCATCCCCACAGTGG + Intergenic
1138542366 16:57696143-57696165 TATCTGCAGCCTCCCAGCTGGGG - Intronic
1140042817 16:71420216-71420238 TCTCCTCTTCCTCCCCTCTGTGG + Intergenic
1141664090 16:85456991-85457013 CTTCCGCAGCCTCCTTTCTGGGG + Intergenic
1142141892 16:88476232-88476254 TCTGCACAGCCTCCCTGCTGGGG + Intronic
1143629286 17:8128238-8128260 TCACTGCAGCCTCCCCTCTCAGG - Intergenic
1144933221 17:18877042-18877064 TCTCCCCAGCCTCACGTCCCAGG - Intronic
1145205313 17:20981698-20981720 TCTCCTCAGCCACCTGACTGTGG - Intergenic
1146063296 17:29618096-29618118 GCTGAGCAGCTTCCCGTCTGCGG + Intronic
1147311759 17:39599688-39599710 TCTCTTCCGCCTCCCGCCTGAGG - Intergenic
1147315400 17:39617911-39617933 TCCCCGCGGCCTCCCGCTTGGGG + Intergenic
1148736027 17:49865397-49865419 TCTCCCCTGCCTCCCGCCTGGGG - Intergenic
1150267156 17:63838959-63838981 TCTCCCCATCCTCACGTCTGTGG - Intronic
1150490830 17:65573243-65573265 CCTCAGCAGCCCCCAGTCTGGGG + Intronic
1150643827 17:66965913-66965935 TCTCCGCAGCCTCCCTGCTGAGG - Intronic
1153978501 18:10290075-10290097 TCTCCCCAGCCTCCCTCCTAGGG + Intergenic
1155249514 18:23941271-23941293 TTTCCCCAGCCTCCCGCCTCTGG + Intronic
1155319963 18:24609353-24609375 ACTCCTCAGCCTCCACTCTGGGG + Intergenic
1161018882 19:1998562-1998584 TCACCGCACCCTCCTGCCTGTGG - Intronic
1161380384 19:3961753-3961775 CCTTCGCCGCCTCCAGTCTGAGG - Intronic
1162125825 19:8499104-8499126 CCTCCGCAGCCTCAGGTCGGTGG - Exonic
1163431135 19:17268503-17268525 TCACCGCAGCCTCCCCTCCCGGG + Intronic
1163697650 19:18772080-18772102 TGACCTCAGTCTCCCGTCTGTGG - Intronic
1164271657 19:23678044-23678066 TCACTGCAGCCTCCCGCCTCTGG - Intronic
1166694500 19:44844938-44844960 TCACCGCAGCCACCCGCCAGGGG - Intergenic
1168120617 19:54250854-54250876 GCTCAGTTGCCTCCCGTCTGAGG + Exonic
1168177792 19:54636788-54636810 GCTCAGTTGCCTCCCGTCTGAGG - Exonic
1168586806 19:57600330-57600352 TCTCCCCAGCCTCCCGGCTCAGG - Intronic
925713325 2:6762675-6762697 TCTCCTCTGACTCCTGTCTGTGG - Intergenic
925739378 2:6992403-6992425 TCCCCGCTGTCTCCCGTCTCTGG - Intronic
928366239 2:30705704-30705726 TCTCCCCTGCCACCCGCCTGAGG + Intergenic
932886582 2:75554419-75554441 TCTCCCCAGCCTGGCATCTGAGG - Intronic
936278565 2:111120179-111120201 TCTTCGCCGCCTCCCGGGTGAGG - Intronic
942047292 2:172107206-172107228 TCACCGCAGCCTCGCAACTGAGG + Intergenic
944715942 2:202376306-202376328 TCGCCGCAGCTGCCAGTCTGCGG - Intergenic
946339365 2:219058173-219058195 TCACCGCAGCCTCAGGGCTGAGG + Intronic
1173823415 20:46032367-46032389 TCCCCGCAGCATCCCCTCTTAGG - Intronic
1174390568 20:50216223-50216245 TCCCCACAGCCTCCAGGCTGGGG - Intergenic
1176141990 20:63548880-63548902 TCTCAGAAACCTCACGTCTGGGG + Intronic
1178678424 21:34650828-34650850 TCTCTGCAGACTCGCATCTGTGG + Intergenic
1179293970 21:40044145-40044167 TGTTGGCAGCCTCCAGTCTGTGG + Exonic
1185001714 22:48250375-48250397 TCTTGGCACCCTCCCGTATGGGG + Intergenic
1185361519 22:50410597-50410619 GTGCCTCAGCCTCCCGTCTGGGG + Intronic
950223361 3:11213657-11213679 TCTCTGGAGCCTCCCTTATGAGG + Intronic
950626628 3:14252301-14252323 ACTCTGCAGCCTCACTTCTGTGG + Intergenic
952393402 3:32900257-32900279 TCCACGCAGCCACTCGTCTGTGG - Intergenic
953199509 3:40766404-40766426 TATCCTCAGCATCCCCTCTGGGG - Intergenic
961601793 3:128068076-128068098 GGTCCCCAACCTCCCGTCTGTGG + Intronic
962075814 3:132080722-132080744 ACACTGCAGCCTTCCGTCTGTGG - Intronic
963804945 3:149713953-149713975 TCCCCGCAGCCTCCCCGCAGTGG - Intronic
964663914 3:159151495-159151517 TCTCCCCAGCCTGTCCTCTGTGG + Intronic
967408810 3:189146975-189146997 TCTGCACAGCGTCCCCTCTGGGG + Intronic
968492247 4:896187-896209 TCACCGCAGCCTCCCGCCCCTGG - Intronic
969837065 4:9850668-9850690 TCACCGCAGCCTCCCTTCACTGG + Intronic
970440635 4:16078367-16078389 GCTTTGCAGCCTCCTGTCTGGGG - Intronic
975571836 4:75825832-75825854 TCTCAGCAGTCTTCCGTCTTTGG + Intergenic
975908908 4:79245776-79245798 TCCGCCCAGCCGCCCGTCTGGGG + Intronic
977317042 4:95463219-95463241 TCCCCGCAGCCACCCGTCTGCGG - Intronic
977814617 4:101400343-101400365 TCTCCTCAGCCTCCCTTCAGGGG - Intergenic
981172077 4:141636686-141636708 TGGCCGCACCCTCCCGGCTGCGG + Exonic
983904518 4:173169466-173169488 CTCCCGCAGCCGCCCGTCTGGGG + Intronic
985031436 4:185794588-185794610 TCTCCCCCGCCACCCCTCTGAGG + Intronic
987109357 5:14670715-14670737 TCTCCTCAGCCTCCTTTCTAGGG + Intronic
992198239 5:74360609-74360631 TCTTGGCAGCCTCCAGTCTTGGG - Intergenic
992635328 5:78720808-78720830 TTAACGCAGCCTCCCCTCTGTGG - Intronic
993500450 5:88660742-88660764 TCTGCGCCACCTCCGGTCTGCGG - Intergenic
996273430 5:121636586-121636608 TCTACACAGACTCCCTTCTGGGG - Intergenic
998538286 5:142954578-142954600 TCTCTACACCCTCCCCTCTGGGG + Intronic
999777063 5:154820055-154820077 TCTGACCAGCCTCCAGTCTGGGG + Exonic
1001534381 5:172488513-172488535 ACCCCCAAGCCTCCCGTCTGAGG - Intergenic
1001794684 5:174492198-174492220 TCTCCAGATCCTCCCGTGTGTGG + Intergenic
1003950505 6:11111422-11111444 TCTCATCAGCCTCCTGTCTGGGG + Intronic
1006387403 6:33739007-33739029 TCCCCACAGCCTCCTGGCTGGGG + Intronic
1006803938 6:36776659-36776681 CCTCTGCAGCCTCCCATCTCTGG + Intronic
1008087080 6:47256446-47256468 TCACTGCAACCTCCCCTCTGGGG - Intronic
1016392735 6:143591556-143591578 TCACAGCAGCCTCAGGTCTGCGG - Intronic
1018899684 6:168044728-168044750 TCTCTGCAGCCGCCCATCTCGGG + Intronic
1019422263 7:956230-956252 ACCCCAAAGCCTCCCGTCTGAGG - Intronic
1021555799 7:21916407-21916429 TCGCCGCAGCCTCGCCTCTGTGG + Intronic
1022241870 7:28520288-28520310 TCTCCGCATCCTCCTGCCTCAGG + Intronic
1031396445 7:121279920-121279942 GCTCTCCAGCCTCCTGTCTGAGG - Intronic
1034536687 7:151729749-151729771 ACACCGCAGGCTCCCTTCTGGGG + Intronic
1035528586 8:333852-333874 TCTCAACACCCTCCCGTCTACGG - Intergenic
1038295462 8:26287883-26287905 TCTCCCCAGCCTCCGTACTGGGG - Intergenic
1043476412 8:80610142-80610164 GTTCAGCAGCCTCCTGTCTGGGG + Intergenic
1045288287 8:100810574-100810596 TCTCCCCAGCTTCCTGTCTCTGG + Intergenic
1049353747 8:142177657-142177679 TGACCCCAGCCTCCGGTCTGCGG - Intergenic
1050187065 9:2985770-2985792 TCTCAGGAGCCTCACTTCTGGGG - Intergenic
1054723412 9:68625915-68625937 TCTCCCCACCTTCCCATCTGTGG + Intergenic
1055458737 9:76496318-76496340 TCTCCGCATCCCCCCTTCAGAGG + Intronic
1061054770 9:128216643-128216665 TCTCCACTGCCTCACGTCTGGGG - Intronic
1189398952 X:40647356-40647378 TCGCCGCAGCCCCCGGCCTGGGG - Exonic
1190988623 X:55522804-55522826 TCCCAGCAGCCTCCCGTCACAGG + Intergenic
1192220131 X:69192107-69192129 TCTCCTCAGCTTCCCATCTGGGG - Intergenic
1199215271 X:145254611-145254633 TGACCGCAGCCTCCCTTCTCAGG - Intronic
1201760129 Y:17528105-17528127 TCACTGCAACCTCCCCTCTGGGG + Intergenic
1201841425 Y:18377885-18377907 TCACTGCAACCTCCCCTCTGGGG - Intergenic