ID: 1081812864

View in Genome Browser
Species Human (GRCh38)
Location 11:45923053-45923075
Sequence CTCTCCGCAGCCTCCCGTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 288}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812864_1081812876 14 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812864_1081812871 3 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812864_1081812866 -7 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812864_1081812868 1 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812864_1081812875 8 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812864_1081812877 15 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812877 11:45923091-45923113 GAGACCCGGGGGCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 317
1081812864_1081812878 16 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812864_1081812869 2 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812864_1081812872 4 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812864 Original CRISPR CTCTCCGCAGCCTCCCGTCT GGG (reversed) Exonic
900198488 1:1390154-1390176 CTCTCCCCCGCCTCCATTCTGGG - Intronic
901061842 1:6475281-6475303 CCCTCCCCACCCTCCGGTCTCGG + Intronic
901592482 1:10356989-10357011 CCCTCCTCAGCCTCCCGAATAGG + Intronic
901639277 1:10685240-10685262 TTCTCCCCAGACTCCCCTCTAGG - Intronic
901879051 1:12183204-12183226 CTCTGAGCCGCCTCCCATCTGGG - Intronic
902768277 1:18631118-18631140 CACTCCGCAGTCTCCGGGCTCGG + Exonic
904115407 1:28158204-28158226 CTCTCCTCACCCTCAAGTCTGGG - Intronic
904239443 1:29134457-29134479 CTCTCCGCTGCCTCCACACTCGG + Intergenic
905713386 1:40127105-40127127 CTCTCTGCAACCTCCCCTCCCGG + Intergenic
906613150 1:47217274-47217296 CTCACCTCAGCCTCCCGAGTAGG - Exonic
907038181 1:51235327-51235349 CTCTCCTGACCCTCCAGTCTGGG - Intergenic
907710442 1:56875880-56875902 CTGTCTGCAGCCTCCCAGCTTGG - Intronic
908128251 1:61050838-61050860 TTCTCCGCGGCCTCCCGCCCGGG - Intronic
911110552 1:94179517-94179539 CTCTCTGCAGCCTCGCCTCCTGG - Intronic
911627783 1:100145632-100145654 CTCACCTCAGCCTCCAGTGTTGG - Intronic
911890279 1:103359886-103359908 CTCACTGCAACCTCCCCTCTCGG - Intergenic
911930291 1:103894393-103894415 CTCACCGCAACCTCCCCTCCTGG + Intergenic
913959571 1:143327974-143327996 CTGTCTGCAGCCTCCCCTGTCGG - Intergenic
914053930 1:144153547-144153569 CTGTCTGCAGCCTCCCCTGTCGG - Intergenic
914125216 1:144812818-144812840 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
914213876 1:145607285-145607307 CTCACCGCAACCTCCCCTCCCGG + Intergenic
914465821 1:147927688-147927710 CTCACCGCAACCTCCCCTCCCGG + Intergenic
915155069 1:153868807-153868829 CTCACTGCAGCCTCCCCTCCTGG + Intronic
916800003 1:168207806-168207828 CGCCCGGCAGCCGCCCGTCTGGG - Intergenic
917979692 1:180261155-180261177 CTCGCCGCCTCCTCCCATCTTGG - Intronic
918053947 1:181002246-181002268 CCCACCTCAGCCTCCCATCTTGG + Intronic
918056062 1:181022890-181022912 CCCTCGGCAGCCTCCAGTCCCGG + Exonic
919874511 1:201853660-201853682 CTCACCTCAGCCTCCCGAGTAGG + Intronic
920442218 1:205988920-205988942 CACTTCCCAGCCTCCCCTCTTGG + Intronic
921187993 1:212686167-212686189 CTCTGCACAGCCTTCCATCTTGG - Intergenic
924466593 1:244304090-244304112 CTCTCCCCAGCCTCCTGTGCAGG - Intergenic
1063042368 10:2356452-2356474 CTCTCCCCAACCCCACGTCTCGG + Intergenic
1063778006 10:9286170-9286192 CTCTCCACAGCCTCTCCTCCAGG - Intergenic
1063946089 10:11177848-11177870 CTCTCCGCAGCCTCCACCATGGG - Intronic
1064274493 10:13893594-13893616 CTCACTGCAGCCTCCCCTCCTGG + Intronic
1064613894 10:17133186-17133208 CCCTCTGAAGCCTCCAGTCTAGG + Intergenic
1064850745 10:19706460-19706482 GTCTCCCCAGCCTCCCTTGTAGG + Intronic
1065073526 10:22052766-22052788 CTCTCCCCAGCCTCCATTCCGGG + Intergenic
1068714617 10:60174808-60174830 CTCACTGCAGCCTCCCCTCCTGG + Intronic
1071311463 10:84347655-84347677 CGCCCGGCAGCCGCCCGTCTGGG - Intronic
1071387616 10:85138287-85138309 CTCTTCGCAGCCACCCACCTGGG - Intergenic
1073008767 10:100344204-100344226 CTCACTGCAGCCTCCCCTCCTGG + Intergenic
1073725771 10:106228490-106228512 CTCACTGCAGCCTCCCCTCCTGG - Intergenic
1074873307 10:117594831-117594853 CTGTTCGCAGCCACCCGTCAGGG - Intergenic
1074917190 10:117968797-117968819 CTCTGCACAGTCACCCGTCTGGG - Intergenic
1075119224 10:119651895-119651917 CTCCCCGCCGCCTGCCGTCGAGG - Intronic
1075377029 10:121986797-121986819 CGGTCCGCCGCCTCCCGTTTTGG + Intergenic
1076739721 10:132477311-132477333 CCCTCCGCAGACTCCAGTCAGGG + Intergenic
1078464419 11:11539637-11539659 CCCTCCGCAGCCTCCCAAGTGGG - Intronic
1080946765 11:36982274-36982296 CTCTGTGCAGCCTCCAGACTTGG - Intergenic
1081812864 11:45923053-45923075 CTCTCCGCAGCCTCCCGTCTGGG - Exonic
1082969100 11:59000260-59000282 CACCCTGCAGCATCCCGTCTGGG + Intronic
1083973533 11:66098718-66098740 CTCTTCACACCCTCCAGTCTGGG + Intronic
1084892442 11:72243322-72243344 CTCTAGGAAGCTTCCCGTCTGGG + Intronic
1085143482 11:74171158-74171180 AACTCCGCAGACTCCCGGCTGGG - Intronic
1085201775 11:74706311-74706333 CTCTCCCTAGCCTCCCATCATGG - Intronic
1085214067 11:74812404-74812426 CTCTCCTCAGCCTCCCAAGTAGG + Intronic
1085609458 11:77933748-77933770 CGCCCAGCAGCCGCCCGTCTGGG + Intronic
1088647554 11:111928686-111928708 CTCACCGCAGCCTCGCCTCTCGG - Intronic
1090961616 11:131562406-131562428 CTCTCCCCACCTTCCCGTCTTGG - Intronic
1091320590 11:134646699-134646721 CTCTCTGCAGCCTCCTTTCTTGG - Intergenic
1091344944 11:134846180-134846202 CTCTTTGCAGCCTCCTCTCTTGG + Intergenic
1091758875 12:3074465-3074487 CTCACCTCAGCCTCCCGTACAGG + Intergenic
1094277018 12:28689110-28689132 CTCTCCACAAGCTCCCCTCTGGG - Intergenic
1095894167 12:47263737-47263759 CTCACTGCAGCCTCCTGCCTCGG - Intergenic
1100595481 12:96068244-96068266 CCCTCCTCAGCCTCCCGAGTAGG + Intergenic
1102104069 12:110305326-110305348 CTCACTGCAGCCTCCACTCTTGG - Intronic
1103059566 12:117847730-117847752 CTCTCCCCAGCATCCCCACTGGG + Intronic
1103075008 12:117974921-117974943 CTCTCCGCACCCTGCTATCTTGG + Intergenic
1103758694 12:123232545-123232567 CTCCCCCAAGCCTCCCGTCAAGG - Intronic
1104111465 12:125708942-125708964 CTCTCCCCTGCCTCCTGTCCTGG - Intergenic
1104895687 12:132162606-132162628 CTGTCCCCAGCCACCCCTCTCGG + Intergenic
1106079200 13:26486680-26486702 CCCTCCCCATCCTCTCGTCTGGG - Intergenic
1110436309 13:75481540-75481562 CGCCCCGCAGCCGCCCGCCTCGG + Exonic
1113953074 13:114082611-114082633 CTCCCAGCTGCGTCCCGTCTGGG + Intronic
1113994804 14:16056909-16056931 CTCTCCCCAGCCTTCCCACTAGG + Intergenic
1114307459 14:21437045-21437067 CCCCCCGCATCTTCCCGTCTTGG - Intronic
1114664181 14:24368662-24368684 CTGTGCGCCGCCTCCCGGCTGGG + Intronic
1117411753 14:55456627-55456649 CTCTGCCCCGCCGCCCGTCTGGG - Intronic
1119649361 14:76372718-76372740 CTCACCTCAGCCTCCCGAGTAGG - Intronic
1121013239 14:90534006-90534028 CTCTGCCCAGCCTGCCTTCTGGG - Exonic
1121079425 14:91095784-91095806 CCCTCCCCAGCTTTCCGTCTGGG + Intronic
1202928986 14_KI270725v1_random:22772-22794 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
1123684819 15:22789386-22789408 CTCTTCAGAGCCTCCCGTCCAGG + Intronic
1123989105 15:25670090-25670112 CTGTCTGCAGCCTCCCTGCTGGG - Intergenic
1125536219 15:40442113-40442135 CGCTCCGCCGCCTCTCTTCTGGG + Intronic
1126485298 15:49173814-49173836 CTCACTGCAGCCTCCGCTCTTGG + Intronic
1129141840 15:73605651-73605673 CTCACCGCAACCTCCCCTCCTGG - Intronic
1129710117 15:77816603-77816625 CTCACCCCAGCCTCCTGACTGGG - Intronic
1130126619 15:81099248-81099270 CTCTCTGCAGCCTCCCATTCGGG - Intronic
1130653177 15:85773792-85773814 CTCTGCGCAGGCTTCCATCTTGG - Intronic
1131059260 15:89394533-89394555 CTCTCCGCAGCACCCCTGCTAGG + Intergenic
1132028488 15:98421799-98421821 CGCTCCGCAGCCTCCCCGCGCGG - Intergenic
1132397409 15:101484246-101484268 CTCTCCCCTCCCTCCCTTCTTGG + Intronic
1134514159 16:14873389-14873411 ATCTCCGCAGCCACTAGTCTGGG - Intronic
1134701801 16:16271888-16271910 ATCTCCGCAGCCACTAGTCTGGG - Intronic
1134970029 16:18522762-18522784 ATCTCCGCAGCCACTAGTCTGGG + Intronic
1136109903 16:28058173-28058195 GGCTCCGGAGCCTCCCGCCTGGG + Intronic
1136861444 16:33706876-33706898 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
1137602114 16:49763388-49763410 CCCACCTCAGCCTCCCGACTGGG + Intronic
1138244111 16:55453675-55453697 CCCTCCTCAGCCTCCCATGTAGG - Intronic
1138542367 16:57696144-57696166 CTATCTGCAGCCTCCCAGCTGGG - Intronic
1138658426 16:58503749-58503771 CTCTGGGCAGCCTCCGCTCTTGG - Intronic
1139373576 16:66483105-66483127 CTCACCTCAGCCTCCCGAGTAGG + Intronic
1141481095 16:84307545-84307567 CTCTGCGTACCCTCCCATCTGGG + Intronic
1141590727 16:85067022-85067044 CTCTAGGCAGCCTCCCCTCCAGG + Exonic
1141780349 16:86155428-86155450 CTCACTGCAGCCTCGAGTCTCGG - Intergenic
1142141891 16:88476231-88476253 CTCTGCACAGCCTCCCTGCTGGG + Intronic
1142254179 16:89006107-89006129 CTCTCCTCAGCCACCCGCGTTGG - Intergenic
1203122943 16_KI270728v1_random:1555067-1555089 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
1142491557 17:283158-283180 CTCTCTGCAGCCCCCCGCCGAGG + Intronic
1144790175 17:17853655-17853677 CTCTCCTCAGCGTGCCCTCTAGG - Intronic
1146078196 17:29753240-29753262 CCCTCCTCAGCCTCCCGAGTAGG + Intronic
1146255973 17:31391753-31391775 CCCTCCGGGGCCGCCCGTCTGGG - Exonic
1147315399 17:39617910-39617932 CTCCCCGCGGCCTCCCGCTTGGG + Intergenic
1147888132 17:43698314-43698336 CACTCCCCAGCCTTCTGTCTTGG - Intergenic
1148044578 17:44735145-44735167 CTCTCCACACCCTCTCCTCTAGG + Intronic
1148461405 17:47841005-47841027 CTCTCCCCAGGCTCCAGGCTTGG + Intronic
1148609638 17:48956108-48956130 CCCGCCGCAGCCTCCCGAGTAGG + Intergenic
1148649942 17:49243137-49243159 CTCACTGCAACCTCCCTTCTGGG + Intergenic
1148736028 17:49865398-49865420 CTCTCCCCTGCCTCCCGCCTGGG - Intergenic
1150250274 17:63700770-63700792 CTCCCCGCAGCCTCGCGGCCGGG - Intronic
1150490828 17:65573242-65573264 CCCTCAGCAGCCCCCAGTCTGGG + Intronic
1151385892 17:73755073-73755095 CTCTCCGAAGCCTCCCGGGGAGG - Intergenic
1151711608 17:75810118-75810140 CTCCCCGCAGCCTACCGCCAGGG - Intronic
1152229711 17:79108370-79108392 CTCTCTGGAGCCTCTCTTCTTGG - Intronic
1153978500 18:10290074-10290096 TTCTCCCCAGCCTCCCTCCTAGG + Intergenic
1154318543 18:13325661-13325683 CGCTGCGCACCCGCCCGTCTCGG + Intronic
1154492608 18:14933314-14933336 CTCTCTGCAGCCTCCTCTCTAGG - Intergenic
1155319962 18:24609352-24609374 CACTCCTCAGCCTCCACTCTGGG + Intergenic
1156330206 18:36114403-36114425 TTCTCAGCAGCCTGCAGTCTTGG - Exonic
1157443616 18:47728837-47728859 TTCTCCAAAGCCTCCGGTCTAGG - Intergenic
1160538744 18:79609302-79609324 CTCTCCTCAGCCTCTCGGCCTGG - Intergenic
1160558746 18:79742880-79742902 CTCACTGCAACCTCCCCTCTGGG - Intronic
1161467164 19:4437421-4437443 CTCACCGCAGCCTCCACTCCTGG + Intronic
1161812505 19:6478840-6478862 CTCTCCACAGCCACCTGCCTTGG - Exonic
1162446007 19:10723206-10723228 CTCACCGCAACCTCCCCTCCTGG + Intronic
1162456919 19:10790838-10790860 CTCACCGCAGCCTCACCACTTGG + Intronic
1162703887 19:12540935-12540957 CTCACCGCAACCTCCACTCTTGG - Intronic
1162947820 19:14054460-14054482 CTCCTCGCCTCCTCCCGTCTTGG + Exonic
1162962805 19:14137674-14137696 CTCTCCACCGCCTCCCGTCTGGG + Intergenic
1163431134 19:17268502-17268524 CTCACCGCAGCCTCCCCTCCCGG + Intronic
1164825819 19:31284268-31284290 CTCTCTGCAGCCTCCCACATGGG + Intronic
1166694501 19:44844939-44844961 CTCACCGCAGCCACCCGCCAGGG - Intergenic
1167330995 19:48856095-48856117 CTCACCGCAACCTCCCCTCCTGG - Intronic
1167615389 19:50530152-50530174 CCCGCCGCAGCCTCCTGCCTGGG + Intronic
1168100331 19:54138059-54138081 CTCCCCGCCGCCTCCCGCCCTGG + Intronic
1168105049 19:54161421-54161443 CTCACTGCAGCCTCCCCTCCCGG + Intronic
1168262413 19:55203525-55203547 CTCACCTCAGCCTCCCGAGTAGG + Intronic
1168342818 19:55635422-55635444 CCCTCCCCAGCCTGCAGTCTGGG - Intronic
1168513548 19:56992615-56992637 CTCTTCCCATCCTTCCGTCTGGG - Intergenic
1168620519 19:57876032-57876054 CTCACCGCAACCTCCCCTCCTGG + Intronic
1202693403 1_KI270712v1_random:106204-106226 CTGTCTGCAGCCTCCCCTGTCGG - Intergenic
925128562 2:1478385-1478407 CTCCCTGCAGGCTCCCGGCTAGG - Intronic
925185826 2:1845661-1845683 CTCTCAGCAGCCCGCTGTCTAGG + Intronic
925263497 2:2547943-2547965 CTCTCTGCATCCTTCCGTATTGG + Intergenic
926625158 2:15085030-15085052 CTCTCCGCAGCTTTCCGCCCTGG + Intergenic
927844952 2:26466660-26466682 GTCTCCTCATCCTCCCATCTGGG - Intronic
927893642 2:26767758-26767780 CCCACCTCAGCCTCCAGTCTGGG - Intronic
928114077 2:28533395-28533417 CTCTCCACAGCCCCCCTTTTTGG + Intronic
928248592 2:29653982-29654004 CTCACCGCAACCTCCCTTCCTGG - Intronic
928400201 2:30972267-30972289 CTGTCTTCAGACTCCCGTCTGGG - Intronic
930114956 2:47710560-47710582 CTCTCCCCAGGGTCCCGACTCGG - Intronic
930344706 2:50165458-50165480 CTTGCCTCAGCCTCCCGACTAGG + Intronic
931246176 2:60494438-60494460 CTCTCCCCATACTCCCATCTTGG - Intronic
932397046 2:71455536-71455558 CTCTCCGCATCCTCAGCTCTGGG + Intronic
933953166 2:87348355-87348377 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
934237396 2:90244700-90244722 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
934459826 2:94208005-94208027 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
935193029 2:100793504-100793526 CTCCCCACAGCCTCCTGCCTGGG + Intergenic
935744806 2:106181119-106181141 CTCTCCGCAGCCCACCCTGTGGG - Intronic
938536663 2:132253846-132253868 CTCTCCCCAGCCTTCCCGCTAGG - Intronic
941495469 2:166195970-166195992 CTCTCTGCAGCCTCAACTCTGGG - Exonic
941919452 2:170834842-170834864 CTCACTGCAACCTCCCCTCTTGG + Intronic
942908005 2:181206705-181206727 CTCTGTGCAGCCTCCAGACTCGG - Intergenic
944857937 2:203785796-203785818 CTCTCCGCAGCCACTGGCCTGGG + Intergenic
946329426 2:219001222-219001244 CCCTCCCCAGCCTCCTGTCCCGG - Intergenic
947264243 2:228259296-228259318 CTCGCCGCAACCTCCCCTCCCGG - Intergenic
1169220793 20:3821444-3821466 CTCACTGCAGCCTCCCCTCCCGG + Intronic
1171767429 20:29297795-29297817 CTCTCCCCAGCCTTCCCACTAGG - Intergenic
1171810491 20:29742199-29742221 CTCTCCCCAGCCTTCCCGCTAGG - Intergenic
1173894795 20:46542504-46542526 CTCACTGCACCCTCCCCTCTCGG - Intronic
1175394121 20:58647171-58647193 CTCTCCAGAGTCTCCCTTCTTGG + Intergenic
1176591007 21:8651359-8651381 CTGTCTGCAGCCTCCCCTGTAGG + Intergenic
1179525997 21:41976154-41976176 CTCTCGGCCACCTCCCGGCTAGG + Intergenic
1180273835 22:10628392-10628414 CTGTCTGCAGCCTCCCCTGTAGG + Intergenic
1180312288 22:11250500-11250522 CTCTCCCCAGCCTTCCCGCTAGG - Intergenic
1181067203 22:20312569-20312591 CTCTCCTCTACCTCCCTTCTTGG - Intergenic
1181758060 22:25039403-25039425 CGCTCCGCAGCCTCAGGTCTTGG + Exonic
1183102257 22:35591221-35591243 CTCTCCCCAGCCTGCCCCCTGGG + Intergenic
1183713433 22:39520076-39520098 CTCCCAGCAGCCGCCCATCTAGG + Intronic
1183984358 22:41561476-41561498 CAAGCCGCAGCCTCCTGTCTGGG + Intronic
1184232441 22:43165818-43165840 CTCTCCTTAGCCTCCCTTCCAGG - Intergenic
1185001713 22:48250374-48250396 CTCTTGGCACCCTCCCGTATGGG + Intergenic
1185124645 22:49001912-49001934 CTCTCTGCAGCTTCCCTTCCTGG + Intergenic
1185361518 22:50410596-50410618 CGTGCCTCAGCCTCCCGTCTGGG + Intronic
949948302 3:9207781-9207803 CTCTCAGCCGCCTGCCCTCTTGG - Intronic
951717393 3:25664271-25664293 CGCGCCGCAGCCACCCGACTTGG + Exonic
954321781 3:49837067-49837089 CTCACCTCAGCCTCCCGAGTAGG + Intronic
956789287 3:72668384-72668406 CTCACAGCAGCCTTCCGTATGGG + Intergenic
962287919 3:134103880-134103902 CTCTCCCTAGACTCCCCTCTAGG + Intronic
962750844 3:138434075-138434097 CTCTCCCCATCCTCTCTTCTAGG - Intergenic
963133039 3:141876265-141876287 CTCTCCGCACCCGCCCGCCGCGG + Intronic
964771160 3:160225588-160225610 GACTCCCCAGCCTCCCGTCCCGG + Intergenic
965077993 3:164003107-164003129 CTCTCCGCAGCCACTGGCCTGGG - Intergenic
965360819 3:167735590-167735612 CTTTCCGCTGCCTCCGGTCCGGG + Intronic
966182323 3:177197907-177197929 CTCCCCGCCCCCACCCGTCTCGG - Intergenic
967006669 3:185390410-185390432 CACTGCGCAGCCTCCCTCCTTGG + Intronic
969454640 4:7294410-7294432 CTCCCCGCAGCCGACCTTCTGGG + Intronic
973926864 4:55747787-55747809 GTCTCCGCACCCTCCTCTCTTGG - Intergenic
975045029 4:69792538-69792560 CTCACTGCAGCCTCCACTCTTGG - Intergenic
975708471 4:77134929-77134951 CTCACCGCAGCCTCCAATCCTGG + Intergenic
975908907 4:79245775-79245797 CTCCGCCCAGCCGCCCGTCTGGG + Intronic
976256262 4:83103742-83103764 CTCACTGCAGCCTCCCTCCTGGG + Intronic
976816029 4:89148978-89149000 CTTTCCGCAGCCTGCCATCCTGG - Intergenic
977275722 4:94975435-94975457 CTCACTGCAGCCTCCCTTCCTGG + Intronic
977814618 4:101400344-101400366 CTCTCCTCAGCCTCCCTTCAGGG - Intergenic
979991465 4:127380074-127380096 CTCTCCGCAGCCACTGGCCTGGG - Intergenic
980817479 4:137967156-137967178 CTCTCCTCAGTGTCCAGTCTTGG + Intergenic
982909536 4:161121807-161121829 CTCTCCCAAGTCTCCCATCTAGG + Intergenic
983225955 4:165086535-165086557 CCCACCTCAGCCTCCCGACTGGG + Intronic
983904517 4:173169465-173169487 CCTCCCGCAGCCGCCCGTCTGGG + Intronic
984431031 4:179649183-179649205 CTCTCCGCATCATCCCATTTGGG + Intergenic
984636013 4:182110434-182110456 CCCTCCTCAGCCTCCCGAGTAGG + Intergenic
986228978 5:5844154-5844176 CTCACTGCAACCTCCCTTCTGGG + Intergenic
986690206 5:10307784-10307806 CTCTCCGCCCCCTCCGGGCTTGG - Exonic
987109356 5:14670714-14670736 CTCTCCTCAGCCTCCTTTCTAGG + Intronic
987144852 5:14982165-14982187 CTCACTGCAGCCTCCCCTCCTGG - Intergenic
988955236 5:36309839-36309861 CTCACTGCAGCCTCCCTTCCAGG + Intergenic
991069843 5:62464541-62464563 CTCACTGCAGCCTCCCTTCCTGG + Intronic
991436549 5:66602166-66602188 CTCTCCTCACTCTCCCGTCATGG - Intronic
992198240 5:74360610-74360632 CTCTTGGCAGCCTCCAGTCTTGG - Intergenic
993000221 5:82373685-82373707 CTCACCGCAACCTCCCCTCCTGG + Intronic
993529189 5:89003840-89003862 CCCTCCGCAGCCGCTGGTCTGGG + Intergenic
996273431 5:121636587-121636609 CTCTACACAGACTCCCTTCTGGG - Intergenic
996364658 5:122688355-122688377 CTCTACGGATCCTCCCATCTCGG + Intergenic
997870425 5:137501049-137501071 CTCTCCCCTCCCTCCCATCTAGG - Intronic
998114504 5:139525841-139525863 CTCACTGCAACCTCCCCTCTGGG - Intergenic
998884747 5:146682602-146682624 CACTCCACAGGCTGCCGTCTGGG + Intronic
999414141 5:151380236-151380258 CCCGCCGCAGCCTCCCACCTAGG - Intergenic
999476858 5:151908078-151908100 CTCTCAGCAGCCTTCCTTCCTGG + Intronic
999649394 5:153750520-153750542 ATCCCAGCAGCCTCCCCTCTAGG - Intronic
999777062 5:154820054-154820076 CTCTGACCAGCCTCCAGTCTGGG + Exonic
1002515873 5:179758464-179758486 CTCACCGCAGTCTCCCTCCTGGG + Intronic
1003862159 6:10332357-10332379 CTCACTGCAGCCTCCTGCCTTGG - Intergenic
1003950504 6:11111421-11111443 CTCTCATCAGCCTCCTGTCTGGG + Intronic
1005625474 6:27658456-27658478 CTCACTGCAACCTCCCCTCTTGG - Intergenic
1007543039 6:42667831-42667853 CTCCCTGCAGCCTCCCCTCCCGG + Intronic
1008087081 6:47256447-47256469 CTCACTGCAACCTCCCCTCTGGG - Intronic
1011126285 6:84011411-84011433 CTCACCACAGCCTCCCTCCTGGG - Intergenic
1011135058 6:84091301-84091323 CTCACTGCAGCCTCCCCTCCTGG + Intergenic
1012472951 6:99591034-99591056 CTCTCCGCAGGCTGCTTTCTAGG + Intergenic
1012760499 6:103294624-103294646 CTCTCCGCAGCCGCTGGCCTGGG + Intergenic
1015626367 6:135183165-135183187 CTCCCAGCCGCCTCCCCTCTGGG - Intronic
1016053378 6:139553532-139553554 CTCACCTCAGCCTCCCGAGTAGG + Intergenic
1016938552 6:149466277-149466299 CTCTCCGCCCCCTCCCATCTCGG - Intronic
1017890048 6:158630419-158630441 CTCACTGCAGCCTCTCCTCTTGG - Intronic
1018537647 6:164838424-164838446 CTCTCTGCAGCCTCCTGCCTTGG - Intergenic
1018899683 6:168044727-168044749 CTCTCTGCAGCCGCCCATCTCGG + Intronic
1020887277 7:13833604-13833626 CCCTCCTCAGCCTCCCAGCTGGG + Intergenic
1024601597 7:50986432-50986454 CTCTCTGCAGCTTTCCTTCTTGG - Intergenic
1024929995 7:54659479-54659501 CTCACCGCAGCCTCCCGGCCTGG - Intergenic
1033185724 7:139225728-139225750 CTCTGCCCAGCTGCCCGTCTAGG + Intergenic
1033185750 7:139225835-139225857 CTCTGCCCGGCCGCCCGTCTAGG + Intergenic
1033185794 7:139226018-139226040 CTCTGCCCAGCCGCCCGTCTAGG + Intergenic
1033185855 7:139226238-139226260 CTCTGCCCAGCTGCCCGTCTAGG + Intergenic
1034410353 7:150937952-150937974 CTCTCCTCAGCATCCCCTGTGGG - Intergenic
1034470286 7:151251240-151251262 CTCTCCTGAGCCACCCCTCTGGG + Intronic
1034536686 7:151729748-151729770 CACACCGCAGGCTCCCTTCTGGG + Intronic
1034899052 7:154896236-154896258 CTCTCACCAGGCGCCCGTCTCGG - Intergenic
1035746667 8:1966172-1966194 CTCCCTGCAGGCTCCCGCCTGGG + Intergenic
1039440809 8:37594229-37594251 CTTACTGCAGCCTCCCGCCTGGG + Intergenic
1040501286 8:48007802-48007824 CTCACTGCAGCCTCACCTCTTGG + Intergenic
1041059405 8:54021951-54021973 CCCCCTGCAGCCTCCCGTCTGGG - Intronic
1043867068 8:85387740-85387762 CTCACCGCAGCCTGCCTCCTGGG + Intronic
1044658827 8:94575662-94575684 CTCTCGTGAGCCTCCTGTCTAGG - Intergenic
1046648372 8:116810271-116810293 CTCACCTCAGCCTCCCGAGTAGG + Intronic
1049045834 8:140150795-140150817 CTCAACGCAGCCTCCAGGCTCGG + Intronic
1050187066 9:2985771-2985793 CTCTCAGGAGCCTCACTTCTGGG - Intergenic
1051888800 9:21922863-21922885 CTCTCATGAGCCTCCTGTCTAGG - Intronic
1051896329 9:21993691-21993713 TTCTCCCCAGCCTCCCGGCGGGG - Intronic
1051989301 9:23131913-23131935 TTCTCCACAGACTCCCTTCTGGG - Intergenic
1053119843 9:35538419-35538441 GTCCCTGCAGCCTCCCTTCTGGG + Intronic
1053690327 9:40583813-40583835 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
1054301578 9:63384774-63384796 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
1055344318 9:75318317-75318339 CTCCCCTCAGCCTCCAGTCAAGG - Intergenic
1057174677 9:92987517-92987539 CTCTCATGAGCCTCCTGTCTAGG + Intronic
1057294281 9:93826486-93826508 CTCTCCGCTGCTTCCCGTGCAGG - Intergenic
1057445467 9:95111474-95111496 CTCTCTGCTGCCTCCCATCACGG + Exonic
1060484575 9:124039080-124039102 CTCTCTGCTGCATCCCGGCTAGG - Intergenic
1061054771 9:128216644-128216666 CTCTCCACTGCCTCACGTCTGGG - Intronic
1061119898 9:128636049-128636071 CTCTCCACAGCCCCCTGTCCTGG + Intronic
1061194569 9:129100755-129100777 CCCTCCGCAGCCTCCTGCCCTGG + Intronic
1061945511 9:133906467-133906489 CTCTCTGCAGCCTTCCTGCTTGG - Intronic
1061992670 9:134168226-134168248 CTCACTGCAACCTCCCGCCTGGG - Intergenic
1203360759 Un_KI270442v1:217941-217963 CTCTCCCCAGCCTTCCCGCTAGG - Intergenic
1203621022 Un_KI270749v1:130083-130105 CTGTCTGCAGCCTCCCCTGTCGG + Intergenic
1185854799 X:3524111-3524133 CTTTCCGCAGCCTCCCTTGCAGG + Intergenic
1186100524 X:6151527-6151549 CTCTCTGCAGGCTCGCCTCTGGG - Exonic
1188158893 X:26776295-26776317 CTCTGTGCAGCCTCCAGACTTGG + Intergenic
1188407425 X:29828858-29828880 CTCTCCCCACCTTCCTGTCTTGG - Intronic
1189398953 X:40647357-40647379 CTCGCCGCAGCCCCCGGCCTGGG - Exonic
1192220132 X:69192108-69192130 GTCTCCTCAGCTTCCCATCTGGG - Intergenic
1194215297 X:91123770-91123792 CTCTCATCAGCCTCCTGTCCAGG - Intergenic
1197769571 X:130081661-130081683 CTCTCATCATCCTCCCGTTTCGG - Intronic
1201077665 Y:10199585-10199607 CTCTCCCCAGCCTTCCCACTAGG + Intergenic
1201760128 Y:17528104-17528126 CTCACTGCAACCTCCCCTCTGGG + Intergenic
1201841426 Y:18377886-18377908 CTCACTGCAACCTCCCCTCTGGG - Intergenic