ID: 1081812865

View in Genome Browser
Species Human (GRCh38)
Location 11:45923054-45923076
Sequence GCTCTCCGCAGCCTCCCGTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 161}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812865_1081812871 2 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812865_1081812866 -8 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812865_1081812868 0 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812865_1081812878 15 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812865_1081812872 3 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812865_1081812875 7 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812865_1081812877 14 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812877 11:45923091-45923113 GAGACCCGGGGGCCGGCCCCGGG 0: 1
1: 0
2: 1
3: 20
4: 317
1081812865_1081812876 13 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812865_1081812869 1 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812865 Original CRISPR GCTCTCCGCAGCCTCCCGTC TGG (reversed) Exonic
900605824 1:3523126-3523148 GCTCTGAGCAGCCTCCCTCCCGG - Intronic
900759370 1:4460751-4460773 GCCCTCCCCAGCCTCCGGTGGGG - Intergenic
900845835 1:5099803-5099825 GCTCTCCACTGCCACCTGTCAGG + Intergenic
901202032 1:7472527-7472549 GCCCTCCGCTGCCTCCCCTGGGG + Intronic
903750419 1:25617503-25617525 GCGCGCCGCAGCCTCCCCTCCGG - Exonic
907962933 1:59299293-59299315 ACCCTCCCCAGCCTCCTGTCAGG - Intronic
908128252 1:61050839-61050861 GTTCTCCGCGGCCTCCCGCCCGG - Intronic
912576255 1:110674992-110675014 GCTCTCCGCCCCCTCCCCTGCGG + Exonic
914818870 1:151084295-151084317 GCTCACCGCAACCTCCCTCCCGG + Intronic
916751034 1:167722535-167722557 GCTCACCGCAGCCGCCCGCCGGG - Intronic
919893394 1:201992562-201992584 GCTCATGGCAGCCTCCCTTCCGG + Intronic
922821372 1:228487797-228487819 GCTCTGCGCCGCCTGCCGTATGG + Exonic
924205842 1:241710686-241710708 TCTCTCATCAGCCTCCCTTCTGG - Intronic
1062774516 10:134920-134942 GCTCGCGGCCGCCTCCCGCCCGG - Intronic
1064247820 10:13683266-13683288 GCTCTCTTCTGCCTCCCGGCAGG - Intronic
1065073525 10:22052765-22052787 TCTCTCCCCAGCCTCCATTCCGG + Intergenic
1073099403 10:100999134-100999156 GTGCTCCCCAGCCTCCCCTCGGG - Intronic
1074873308 10:117594832-117594854 CCTGTTCGCAGCCACCCGTCAGG - Intergenic
1074917191 10:117968798-117968820 GCTCTGCACAGTCACCCGTCTGG - Intergenic
1076703948 10:132290993-132291015 GCTCTCCCCTGCCTCCCTTCCGG + Intronic
1076739719 10:132477310-132477332 GCCCTCCGCAGACTCCAGTCAGG + Intergenic
1077420357 11:2447105-2447127 GCTCACTGCAGCCACCCGTGTGG + Intronic
1081812865 11:45923054-45923076 GCTCTCCGCAGCCTCCCGTCTGG - Exonic
1084892441 11:72243321-72243343 GCTCTAGGAAGCTTCCCGTCTGG + Intronic
1085143483 11:74171159-74171181 GAACTCCGCAGACTCCCGGCTGG - Intronic
1085518849 11:77126583-77126605 GCCCTCAGCAGCCTCCGCTCTGG - Intergenic
1085784810 11:79440099-79440121 GCTCGCCCCAGGCCCCCGTCGGG - Intronic
1090629285 11:128632493-128632515 GCTCTTCCCAGGCTCCCATCTGG + Intergenic
1092899471 12:13044734-13044756 CCTCTCGCCAGCCTCCCCTCGGG - Intronic
1098441686 12:70525798-70525820 GCTCTCAGCAGCCTCCAGCCAGG + Intronic
1100507225 12:95234358-95234380 GCTCACCGCAACCTCCCCGCCGG + Intronic
1103155306 12:118679820-118679842 GCTCACTGCAGCCTCCCTCCCGG + Intergenic
1103671644 12:122621422-122621444 GCTCACTGCAGCCTCCCTCCCGG + Intronic
1114664180 14:24368661-24368683 GCTGTGCGCCGCCTCCCGGCTGG + Intronic
1115415385 14:33126520-33126542 GCTCTCCCCACCCACCCGCCTGG - Intronic
1115591896 14:34873846-34873868 TCCGTCCGCGGCCTCCCGTCCGG - Intronic
1117278998 14:54219506-54219528 GCTCTCCGCAGCCTGACTCCAGG + Intergenic
1121274314 14:92657466-92657488 GCCCTCAGCAGCCTCACGTCAGG - Intronic
1122613285 14:103000350-103000372 GCTCTACGCAGGCTCACCTCGGG - Intronic
1122792911 14:104191989-104192011 GCACAGTGCAGCCTCCCGTCGGG + Intergenic
1123989106 15:25670091-25670113 GCTGTCTGCAGCCTCCCTGCTGG - Intergenic
1128148250 15:65344659-65344681 GCTCTCAGCAGCCTCTAGGCTGG + Intronic
1128720340 15:69943252-69943274 GCTGTCAGCAGCCTCCTCTCAGG - Intergenic
1130126620 15:81099249-81099271 ACTCTCTGCAGCCTCCCATTCGG - Intronic
1132650607 16:1019868-1019890 GCCCTCCGCTGCCTTCCCTCAGG - Intergenic
1133078005 16:3295007-3295029 GCTCTCCTGGGCCTCCCGGCAGG + Intronic
1133643490 16:7740699-7740721 GCTCTGCGCAGCTTCCTCTCTGG - Intergenic
1136390698 16:29962293-29962315 GCCCTGCCCCGCCTCCCGTCCGG - Intronic
1136459596 16:30401364-30401386 GCTCACTGCAGCCTCCGCTCGGG + Intergenic
1138516073 16:57536202-57536224 GCCCGCCGCCCCCTCCCGTCCGG + Intronic
1139941793 16:70610837-70610859 GCTCTCCGTGGCTTCCCGGCAGG - Intronic
1139956360 16:70694933-70694955 GCTGTCCCCAGCCACCCCTCCGG - Intronic
1141809335 16:86364411-86364433 GCTCCCTGCAGCCTCCCGCCTGG + Intergenic
1146121978 17:30203735-30203757 CCTCTCCGCAGCCCCCCGCCAGG + Intronic
1146255975 17:31391754-31391776 GCCCTCCGGGGCCGCCCGTCTGG - Exonic
1146260183 17:31415818-31415840 GGTCTCCGCAGCCTCCCAGCTGG + Intronic
1146332260 17:31937193-31937215 GCTCTCCGGGGCCGCCCGGCGGG + Exonic
1147223167 17:38952247-38952269 GCTCACCGCAGCCTCTACTCAGG - Intronic
1148020354 17:44549141-44549163 GCTCACTGCAGCCTCCACTCAGG + Intergenic
1148649941 17:49243136-49243158 GCTCACTGCAACCTCCCTTCTGG + Intergenic
1148736029 17:49865399-49865421 TCTCTCCCCTGCCTCCCGCCTGG - Intergenic
1149517753 17:57293218-57293240 TCTCTCCCCAGCCTCCCCTGTGG - Intronic
1150250275 17:63700771-63700793 CCTCCCCGCAGCCTCGCGGCCGG - Intronic
1150490826 17:65573241-65573263 GCCCTCAGCAGCCCCCAGTCTGG + Intronic
1151388684 17:73770995-73771017 GGTCTCTGCAGCCTGCCATCAGG + Intergenic
1151711609 17:75810119-75810141 CCTCCCCGCAGCCTACCGCCAGG - Intronic
1158448250 18:57539958-57539980 GCTCTCAGCAGCCTCCCAGAGGG - Intergenic
1159524287 18:69568027-69568049 GCTCCCCGCGGCCTGCCTTCAGG + Intronic
1160072758 18:75642979-75643001 CCACTCCGCAGCCTGCTGTCAGG - Intergenic
1160558747 18:79742881-79742903 GCTCACTGCAACCTCCCCTCTGG - Intronic
1160868469 19:1266523-1266545 GCTCTCTACCGCCTCCCGCCCGG + Intronic
1161183510 19:2900992-2901014 GCTCTCCGTGGCCTCGCGGCCGG - Exonic
1162395832 19:10417720-10417742 CCTCGCCGCCGCCTCTCGTCCGG + Intronic
1162962804 19:14137673-14137695 TCTCTCCACCGCCTCCCGTCTGG + Intergenic
1163698591 19:18776074-18776096 CCTCTCGGCGGCCTCCTGTCTGG + Intronic
1164156970 19:22602914-22602936 CCTCCCCGCAGCCCCCCGCCGGG - Intergenic
1164615705 19:29665709-29665731 GCTCTCCCCAGGCTCCCTGCAGG - Intronic
1166542439 19:43614368-43614390 GCTCTCCACAGCCACACCTCCGG + Exonic
1166694502 19:44844940-44844962 TCTCACCGCAGCCACCCGCCAGG - Intergenic
1166818884 19:45564261-45564283 GGTCTCAGCAGCCTCCCTGCTGG - Intronic
1167598012 19:50437462-50437484 CCTCTCCCCAGCACCCCGTCAGG + Exonic
1167615387 19:50530151-50530173 GCCCGCCGCAGCCTCCTGCCTGG + Intronic
927714171 2:25341771-25341793 GCTCCCCGCCGCCTCCGGGCCGG + Intronic
931516333 2:63052490-63052512 GCTCTGGGCGGCCTGCCGTCCGG + Intronic
932764595 2:74461872-74461894 GCTCTCTGCTGCCTCCAGTGAGG + Exonic
935349723 2:102142813-102142835 GCTCTCCGGCTCCTCCCGGCCGG - Exonic
936092427 2:109510123-109510145 GCTCTCCCCAGCCTCGGGTTGGG - Intergenic
941495470 2:166195971-166195993 GCTCTCTGCAGCCTCAACTCTGG - Exonic
1171482364 20:25463575-25463597 GCTGTCTGCAGCCACCTGTCAGG + Intronic
1174475893 20:50795299-50795321 GCGCCCCGCAGCCACCCTTCAGG - Intronic
1179283113 21:39951899-39951921 GATTTCCCCAGCCTCCCGACTGG + Intergenic
1180004270 21:45012855-45012877 CCTCTCTGCAGCCTCCTGCCAGG - Intergenic
1180131720 21:45830940-45830962 GCTCTTGGCAGCTTCCCGGCCGG + Intronic
1182357885 22:29730432-29730454 GCTCTGAGCAGCCTCCAGCCAGG + Exonic
1182704673 22:32269703-32269725 GCTCTCAGCAGCCTCACCACAGG + Intergenic
1183099361 22:35574487-35574509 GCTCCCCGCTGACTTCCGTCGGG + Intergenic
1183102256 22:35591220-35591242 GCTCTCCCCAGCCTGCCCCCTGG + Intergenic
1183816748 22:40308212-40308234 GCTGGCCCCAGCCTCCTGTCTGG + Intronic
1184226000 22:43129138-43129160 GCACTCCGCTGTCACCCGTCTGG + Intronic
1185343349 22:50301086-50301108 GCCCTCCTCAGCCTCCTCTCTGG + Intronic
950097297 3:10337695-10337717 GCTCTCCCCAGCTTCCCCTAGGG - Intronic
956155023 3:66286750-66286772 GCTCACTGCAGCCTCCCTTCTGG + Intronic
960149201 3:114232950-114232972 GCCCTTCACAGCCTCCAGTCAGG - Intergenic
961098829 3:124180983-124181005 GCTCACCTCAGCCTCCCGAAGGG - Intronic
962919003 3:139934944-139934966 GCTCTCCGGAGCCGCCCACCAGG + Intergenic
965360818 3:167735589-167735611 GCTTTCCGCTGCCTCCGGTCCGG + Intronic
967267478 3:187703144-187703166 GCTCAAGGCAGCCTCCCTTCAGG - Intronic
968703349 4:2066957-2066979 GCTGCCCGGAGCCTCTCGTCAGG - Exonic
968758704 4:2430067-2430089 GCTGTCCGCAGTCTGCCGTTTGG - Intronic
968758723 4:2430256-2430278 GCTGTCCGCAGTCTGCCGTTTGG - Intronic
968946356 4:3666691-3666713 GCTCTCAGCAGTCTCCCCTGGGG - Intergenic
974935326 4:68404306-68404328 TCTCTCTGAAGCCTCCCATCTGG + Intergenic
976256261 4:83103741-83103763 GCTCACTGCAGCCTCCCTCCTGG + Intronic
977814619 4:101400345-101400367 ACTCTCCTCAGCCTCCCTTCAGG - Intergenic
985536099 5:466459-466481 GCTCTCCACGGTCTCCCCTCTGG + Intronic
985778238 5:1856668-1856690 GCTCGTCCCAGCCTCACGTCCGG - Intergenic
986228977 5:5844153-5844175 GCTCACTGCAACCTCCCTTCTGG + Intergenic
986276385 5:6278821-6278843 GCCCTCCTCAGCATCCAGTCAGG - Intergenic
994116147 5:96063152-96063174 GCTGTCCACATCCTCCCTTCAGG + Intergenic
998114505 5:139525842-139525864 GCTCACTGCAACCTCCCCTCTGG - Intergenic
998129697 5:139645395-139645417 GCTTTCCACAGCCTCCAGTGAGG - Intergenic
1001773432 5:174312066-174312088 GCACCCCGCAGCTGCCCGTCCGG - Intergenic
1002515872 5:179758463-179758485 GCTCACCGCAGTCTCCCTCCTGG + Intronic
1003950503 6:11111420-11111442 GCTCTCATCAGCCTCCTGTCTGG + Intronic
1004579002 6:16929252-16929274 GCTCTCCTCAGCCTCCCAGAGGG + Intergenic
1006644824 6:35508957-35508979 GCTCTCTGAGGCCTCCCCTCTGG - Intronic
1006774329 6:36580317-36580339 GCTCACTGCAGCCTCCCTTATGG + Intergenic
1007236952 6:40397364-40397386 GGACTCAGCAGCCTCCAGTCAGG + Intronic
1007623672 6:43229903-43229925 GCTCTCCACAGCCTCCTAACAGG + Intergenic
1007756371 6:44102234-44102256 TCTCTCCCCAGCCTCTCGTTGGG + Intergenic
1008087082 6:47256448-47256470 GCTCACTGCAACCTCCCCTCTGG - Intronic
1011112549 6:83853969-83853991 GCTCTCAGCAGCCTCGCTCCCGG - Intronic
1011126286 6:84011412-84011434 GCTCACCACAGCCTCCCTCCTGG - Intergenic
1017810709 6:157981742-157981764 GCGCGCCGCCGCCTCCCGCCCGG - Intergenic
1019576643 7:1740729-1740751 GCCCTGTGCAGCCTCCTGTCAGG - Intronic
1019587298 7:1812559-1812581 GCTCCCTCCAGCCTCCCGGCAGG - Intergenic
1020887275 7:13833603-13833625 GCCCTCCTCAGCCTCCCAGCTGG + Intergenic
1022674516 7:32485885-32485907 GCTCCCTGCAACCTCCAGTCAGG - Exonic
1022810579 7:33864177-33864199 TCTCTCCCCAACCTCCTGTCAGG - Intergenic
1023955789 7:44885574-44885596 GCCCTCCGCGGCCTCGCGGCCGG + Intergenic
1024082059 7:45864115-45864137 GCTCTCAGCAGCCTCCCTAGAGG - Intergenic
1030484560 7:110149409-110149431 CCTCCCCTCAGCCTCCCTTCAGG + Intergenic
1034470285 7:151251239-151251261 GCTCTCCTGAGCCACCCCTCTGG + Intronic
1035062354 7:156079100-156079122 GCCCTCCCCAGTCTCCCTTCGGG + Intergenic
1035310613 7:157965573-157965595 GCTCTCCCCAGTCACCCCTCAGG + Intronic
1035746666 8:1966171-1966193 GCTCCCTGCAGGCTCCCGCCTGG + Intergenic
1035991540 8:4496373-4496395 GCTCTCTCCAGCCCCCTGTCAGG - Intronic
1038481081 8:27902232-27902254 GCTCTGGACAGCCTCCCCTCAGG - Intronic
1041059407 8:54021952-54021974 TCCCCCTGCAGCCTCCCGTCTGG - Intronic
1042591405 8:70402534-70402556 GCTCCCCGCCTCCTCCCCTCGGG - Intronic
1043588478 8:81797570-81797592 GCTCACTGCAGCCTCACCTCTGG + Intergenic
1043867067 8:85387739-85387761 GCTCACCGCAGCCTGCCTCCTGG + Intronic
1049039156 8:140099362-140099384 GTTCTCCGCAGCCTTCCGCAGGG + Intronic
1049408807 8:142463422-142463444 CCATTCCCCAGCCTCCCGTCTGG - Intronic
1049472191 8:142781405-142781427 GCTCTCCTCACCGTCCAGTCGGG - Intergenic
1050187067 9:2985772-2985794 GCTCTCAGGAGCCTCACTTCTGG - Intergenic
1050896676 9:10891351-10891373 GATCTCCACAGCCTCCTTTCAGG - Intergenic
1051896330 9:21993692-21993714 TTTCTCCCCAGCCTCCCGGCGGG - Intronic
1053072252 9:35108203-35108225 GCCCTTCACAGCCTCCAGTCAGG - Exonic
1053119842 9:35538418-35538440 GGTCCCTGCAGCCTCCCTTCTGG + Intronic
1056659801 9:88535359-88535381 GCTCGCCGCCGCCTCCCCGCAGG + Exonic
1056870208 9:90270184-90270206 ACTCTCCTCAGCTTCCCATCAGG + Intergenic
1058174867 9:101724335-101724357 GCCCTCCGCAGCCTCTGGCCCGG + Intronic
1058885864 9:109320764-109320786 GCAGCCCGCAGCCGCCCGTCCGG - Exonic
1059623016 9:116029695-116029717 GCTCACCACAGCCTCCCAACGGG - Intergenic
1060541661 9:124435059-124435081 GCTCACTGCAGCCTCACCTCGGG + Intergenic
1060602680 9:124888606-124888628 GCTCTCCCCTGCCTACCGACAGG + Intronic
1061034809 9:128107573-128107595 GCTCTCCCCACCCTCCCTGCGGG - Exonic
1061054772 9:128216645-128216667 CCTCTCCACTGCCTCACGTCTGG - Intronic
1061600962 9:131669743-131669765 GCCCTCAGGAGCCTCCCGTGGGG - Intronic
1061992671 9:134168227-134168249 GCTCACTGCAACCTCCCGCCTGG - Intergenic
1062536714 9:137024287-137024309 GCCCTCCCCAGCCTCCCATAGGG + Intronic
1062718558 9:138023244-138023266 GGCCTCCGCAGCCTCAGGTCGGG - Exonic
1192220133 X:69192109-69192131 GGTCTCCTCAGCTTCCCATCTGG - Intergenic
1192805468 X:74504877-74504899 TCTCACCTCAGCCTCCCGTGTGG - Intronic
1200061184 X:153484523-153484545 GCCCTCCTCAGCCTCCCGCCTGG - Intronic
1201760127 Y:17528103-17528125 GCTCACTGCAACCTCCCCTCTGG + Intergenic
1201841427 Y:18377887-18377909 GCTCACTGCAACCTCCCCTCTGG - Intergenic