ID: 1081812866

View in Genome Browser
Species Human (GRCh38)
Location 11:45923069-45923091
Sequence CGGAGAGCCGCCGCCCTCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812853_1081812866 18 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812855_1081812866 13 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812852_1081812866 19 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812851_1081812866 20 Left 1081812851 11:45923026-45923048 CCCCGGCCCGCTCATGCCACGTG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812864_1081812866 -7 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812863_1081812866 -6 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812861_1081812866 -4 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812865_1081812866 -8 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812862_1081812866 -5 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812854_1081812866 14 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47
1081812858_1081812866 4 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG 0: 1
1: 0
2: 0
3: 2
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812866 Original CRISPR CGGAGAGCCGCCGCCCTCGA CGG Exonic
901084604 1:6602903-6602925 CGGGGCGCCGCGGCTCTCGAGGG + Intronic
915004468 1:152623451-152623473 CAGAGAGACGCCACCCTGGAGGG - Intergenic
1066406990 10:35127403-35127425 CGGCGAGCCGGCGGCCTCGGGGG - Intronic
1078091783 11:8268562-8268584 CGGAGAGCCGCGACCGCCGACGG + Intronic
1081812866 11:45923069-45923091 CGGAGAGCCGCCGCCCTCGACGG + Exonic
1084524264 11:69686082-69686104 CGCAGAGCCGCCTCCCTCCCGGG + Intergenic
1084533536 11:69743389-69743411 TGGAGAGGGGCCGCCCACGATGG + Intergenic
1089792656 11:120955877-120955899 CTGAGAGCCACTGGCCTCGATGG - Intronic
1091823372 12:3492214-3492236 CGGAGAGCCCCCGGCCGCGGGGG + Intronic
1095972927 12:47916725-47916747 TGGAGAGCAGCTGCCCTGGAGGG - Intronic
1105378284 13:19863972-19863994 CGGAGAGCCCCGGGCCCCGAGGG - Intergenic
1106540154 13:30683354-30683376 AGGAGAGCCACTGCCCTAGAAGG + Intergenic
1122789327 14:104177702-104177724 TGGAGAGCTGCCGCCCGCCATGG + Exonic
1139371081 16:66469864-66469886 CGGTGAGCCGCCGCCCACCCTGG + Exonic
1142225361 16:88874463-88874485 TGGAGAACCGCAGCCCTGGAAGG + Intergenic
1142355481 16:89599636-89599658 CGGTGAGCTGGCGCCCTGGAGGG + Intergenic
1147183867 17:38703607-38703629 CGGAGCGCGGCCGTCCTCGCCGG + Intergenic
1151537578 17:74747708-74747730 CGGAGAGCCTGGGACCTCGAGGG - Intergenic
1160768924 19:821788-821810 CGGAGACCCCCCGCCCTCCTCGG - Intronic
1161408264 19:4102439-4102461 CAGGGAGCCGCCGTCCTAGAGGG + Exonic
1162817999 19:13207762-13207784 CGGAGATCGGCCGCCCACGGGGG - Exonic
1164617924 19:29677696-29677718 CGGACAGCTGCCGGCCTCCATGG - Intergenic
1165553192 19:36605625-36605647 CGGGGACCCGCCGCCAGCGATGG - Intronic
1165886782 19:39084379-39084401 CGGGCAGCCGGCGCCCCCGAGGG + Exonic
1167249181 19:48391584-48391606 AGGAGAGGCTCCGCCCCCGAGGG + Intergenic
1167611765 19:50511161-50511183 CCCAGAGCCGCCGCCCAGGAAGG - Exonic
925587875 2:5481595-5481617 GGGAGAGAAGCAGCCCTCGAAGG - Intergenic
939624991 2:144465930-144465952 CAGAAAGCCGCCGCAATCGACGG - Intronic
944579182 2:201117103-201117125 GTGGGAGCCGCCGCCCTGGAGGG + Intronic
947636165 2:231681550-231681572 AGGAGAGCCGCAGCCCGGGAAGG - Intergenic
1172474414 20:35226578-35226600 CGGGGAGCCACTGCCCTCGCAGG + Intergenic
1173843613 20:46174650-46174672 CGGCGAGTCCGCGCCCTCGAAGG + Exonic
1175218782 20:57405257-57405279 CACAGAGCCCCTGCCCTCGAGGG - Intronic
1183467291 22:37986178-37986200 CGGAGAGGAGCCGCCCTGGATGG + Intronic
1183647385 22:39134489-39134511 TGGAGAGCCACAGCCATCGACGG - Exonic
950316393 3:12004936-12004958 CCGGGCGCCGCCGCCCTCGGGGG + Intronic
952327724 3:32335992-32336014 CTGAGAGTCGCTGCCCTGGAGGG - Intronic
953889780 3:46743241-46743263 TGAAAAGCCCCCGCCCTCGAAGG + Intronic
966868719 3:184276533-184276555 CGGGGAGGCCCCGCCCTCTACGG - Intronic
1004492403 6:16129198-16129220 CGCAGAGCTGCAGCCTTCGAGGG + Exonic
1037807465 8:22066631-22066653 TGGAGAGCGGCCGCCCGCGGAGG + Intronic
1047454739 8:124998577-124998599 GCGAGAGCCGCCGCCCGCGAGGG + Exonic
1049721033 8:144115649-144115671 CGGAGAGCCGCCGCCGCTGGAGG + Exonic
1051591107 9:18777334-18777356 CGGAGAGCTGCTGGCCTCGTGGG + Exonic
1052355806 9:27503791-27503813 GAGAGAGCCACCGCCCTGGAGGG + Intronic
1057489271 9:95508872-95508894 CGCAGAGCCGCCGCCGCCGCGGG + Intronic
1062564741 9:137159165-137159187 CTGAGAGCCTCTGCCCTCGCCGG + Intronic
1062642923 9:137530531-137530553 CGTGGAGCCGCCACCCACGAGGG - Intronic
1062718563 9:138023265-138023287 CGGAGGGTCGACGCCCTCGGGGG - Exonic
1186404740 X:9291904-9291926 CGGAGAGCCGCAGCCCTGCCGGG - Intergenic