ID: 1081812868

View in Genome Browser
Species Human (GRCh38)
Location 11:45923077-45923099
Sequence CGCCGCCCTCGACGGAGACC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812853_1081812868 26 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812864_1081812868 1 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812852_1081812868 27 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812851_1081812868 28 Left 1081812851 11:45923026-45923048 CCCCGGCCCGCTCATGCCACGTG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812855_1081812868 21 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812865_1081812868 0 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812854_1081812868 22 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812861_1081812868 4 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812862_1081812868 3 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812858_1081812868 12 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66
1081812863_1081812868 2 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812868 Original CRISPR CGCCGCCCTCGACGGAGACC CGG Exonic
902457527 1:16545960-16545982 CGCCTCCCACGCGGGAGACCCGG - Intergenic
902483688 1:16727312-16727334 CGCCTCCCACGTGGGAGACCCGG + Intergenic
902494638 1:16861948-16861970 CGCCTCCCACGCGGGAGACCCGG + Intronic
908401135 1:63774062-63774084 CGCCGCCGCCGAGGGAGCCCCGG + Exonic
913662522 1:121016866-121016888 CGCCTCCCACGCGGGAGACCCGG - Intergenic
1064244298 10:13657056-13657078 CGCCGCCCTCGATGTACAGCGGG + Exonic
1069769489 10:70888370-70888392 CGCCGCCAGCGACAGAGAGCCGG + Intronic
1073425368 10:103452523-103452545 CTCCGCCCTCGGCCCAGACCCGG + Intergenic
1074055972 10:109923253-109923275 GGCCGCGCTCGCCGGAGCCCCGG - Intronic
1074987304 10:118669611-118669633 CGCAGCCTTGGACGGAGGCCTGG + Intergenic
1076146490 10:128126295-128126317 CGCCGCCTCTGACGGGGACCCGG + Exonic
1077553642 11:3215494-3215516 GGCCGCCCTCTGTGGAGACCTGG + Intergenic
1080418601 11:32091463-32091485 CGCCGCCCCCCACGGGGCCCTGG - Intronic
1081812868 11:45923077-45923099 CGCCGCCCTCGACGGAGACCCGG + Exonic
1096204164 12:49707293-49707315 CGGCGCCCTCGACGGGGCCGAGG - Exonic
1101371800 12:104137786-104137808 CCCCGCTCTCGACGGCGTCCCGG - Intronic
1105472021 13:20703582-20703604 CGCCGCCAGCGAGGGAGCCCCGG - Intronic
1108689173 13:52846858-52846880 GGCCGCCCGCGACCGGGACCTGG - Exonic
1110450718 13:75635880-75635902 CGCCGCCCTCACCTGAGCCCCGG - Intronic
1111822187 13:93227746-93227768 CGCCGCCCAACACGGAGACGCGG - Intronic
1113517502 13:110914829-110914851 CGCCTGCCGCGACGGGGACCTGG - Exonic
1118610127 14:67533299-67533321 CGTCGCTCTCGCCGGAGTCCCGG - Exonic
1118873960 14:69767174-69767196 CGTCGACCTCCACGCAGACCAGG - Exonic
1124291304 15:28455920-28455942 CGCCACCCTCGATGTTGACCTGG - Intergenic
1131154836 15:90068355-90068377 GGCCGCACTCGACGCAGACATGG - Exonic
1132055698 15:98649089-98649111 CGCCGGCCTCGCCTGTGACCCGG + Exonic
1133104303 16:3496585-3496607 CGCCGTCCTTGAGGGAGTCCAGG - Intergenic
1139431841 16:66914990-66915012 CTCCACACTCCACGGAGACCTGG - Intronic
1144758442 17:17694134-17694156 CGCTGCCCTCCCAGGAGACCCGG - Intronic
1150211985 17:63446585-63446607 CGCGGCCCTCGAGGCAGGCCCGG - Intergenic
1150614121 17:66755798-66755820 CGCCTCCCACGTGGGAGACCTGG + Intronic
1151919236 17:77141153-77141175 CGCCGGACTCCACGGAGACCGGG - Intronic
1152049240 17:77959247-77959269 CGCCGCCGGGGACGGAGCCCAGG + Intergenic
1152714301 17:81891240-81891262 GGCCGCTCGCGGCGGAGACCCGG - Intronic
1154266589 18:12884025-12884047 CGCCGACCTCCTCCGAGACCCGG - Intronic
1158959702 18:62579418-62579440 CGCCGCCCTTGACGCAGTCCTGG + Intronic
1161531363 19:4791995-4792017 CGCCGCCCGCTACGGCCACCTGG + Exonic
1162479647 19:10920985-10921007 GGCCGCCCTCGCCGCAGGCCTGG + Intronic
1162562068 19:11422670-11422692 CGCCGCCCTCCCCAGAGCCCCGG + Intronic
1167578357 19:50328410-50328432 AGGCGCCCACGACGGAGGCCTGG - Exonic
1168347671 19:55658906-55658928 CTCAGCCCTCGAGGGGGACCAGG + Intronic
927519161 2:23688884-23688906 CGCAGCCCTCGTCAGCGACCAGG + Intronic
927658429 2:24971677-24971699 CGCACCCCTCGGCTGAGACCCGG + Intronic
934567047 2:95346844-95346866 CGCCGCCCTCCACGGGGCCCCGG + Intronic
945699480 2:213152038-213152060 CCCCGCCCCCGACGGGGGCCAGG + Intronic
946395565 2:219442204-219442226 CGCCGCCCTCGGCGGGGCTCGGG - Intronic
947860230 2:233353309-233353331 CGCCGCCCTGGGCAGTGACCTGG - Intergenic
1171544021 20:25987170-25987192 CGCCGCCCTCTACTGGGTCCTGG + Intergenic
1175394669 20:58650324-58650346 GGCGTCCCGCGACGGAGACCCGG - Intergenic
1176000066 20:62827684-62827706 CACCTCCCTCGACTGAGCCCTGG + Intronic
1176178915 20:63740596-63740618 CACCGGCCCCGACGGAGGCCAGG + Intronic
1178695825 21:34792314-34792336 CGCCGCCCACCATGGAGAACTGG + Exonic
1182576479 22:31276580-31276602 CGCCGCCCTCGCCGCGGAGCCGG + Intronic
1183466544 22:37983135-37983157 CGCCGCCCCGTAGGGAGACCCGG + Intronic
949260501 3:2098843-2098865 CGCCGCGCCAGACGGAGCCCGGG + Intronic
961340373 3:126213279-126213301 CGGCGGCCTGGAGGGAGACCCGG + Intergenic
970421052 4:15906045-15906067 CGCCGCCCTCGGCAGGCACCCGG - Intergenic
979623987 4:122826624-122826646 CCCCGCCCCCGACTGAGGCCGGG + Intergenic
982000412 4:151016235-151016257 CGCCGCTCTCGGCGGAGACTTGG + Intergenic
985493604 5:192898-192920 GGCCTCCCTCGAGGGAGACTGGG - Intronic
997291216 5:132737211-132737233 GGCCGGCCTCGACAGGGACCTGG - Intronic
1019298399 7:290827-290849 CGCCGCCCCCGACGGGCCCCGGG + Intergenic
1019530149 7:1499217-1499239 CGCCGCCCCCAACTGGGACCGGG + Intronic
1029338085 7:99919317-99919339 GGCCGCACTCGATGGACACCGGG + Exonic
1041449893 8:57994969-57994991 GGCCGGGCTCAACGGAGACCCGG - Intronic
1049651514 8:143771917-143771939 CGCCGCCTTCGACGGGGACGTGG + Intergenic
1049673147 8:143878507-143878529 CGCCGCCCTAGACGGGGGCGGGG - Intergenic
1054709909 9:68500864-68500886 CTCCGCACTGGACTGAGACCAGG + Intronic
1054835523 9:69672083-69672105 TGCGGCCCCCGACGGAGCCCGGG - Intronic
1061714213 9:132508896-132508918 AGCCGCCCTGGAGGGAGACTCGG - Intronic
1062153267 9:135032332-135032354 CCCCGCCCTGGTCGGGGACCTGG + Intergenic
1198808511 X:140511181-140511203 CGCTGCTCGCGACGGAGAGCGGG + Intergenic