ID: 1081812869

View in Genome Browser
Species Human (GRCh38)
Location 11:45923078-45923100
Sequence GCCGCCCTCGACGGAGACCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 86}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812863_1081812869 3 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812864_1081812869 2 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812851_1081812869 29 Left 1081812851 11:45923026-45923048 CCCCGGCCCGCTCATGCCACGTG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812854_1081812869 23 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812865_1081812869 1 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812852_1081812869 28 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812855_1081812869 22 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812858_1081812869 13 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812862_1081812869 4 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812861_1081812869 5 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86
1081812853_1081812869 27 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG 0: 1
1: 0
2: 0
3: 9
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812869 Original CRISPR GCCGCCCTCGACGGAGACCC GGG Exonic
900290754 1:1922637-1922659 GCCGCGCTCCACGGAGCCCCTGG + Intronic
901005675 1:6170561-6170583 GCCACCCTTGAGGGAGGCCCTGG - Intronic
901489433 1:9589119-9589141 GCCCCCCTCGGCCGGGACCCGGG + Intronic
901557833 1:10045694-10045716 GCGGCCATCGAAGGAGTCCCAGG + Intronic
902457526 1:16545959-16545981 GCCTCCCACGCGGGAGACCCGGG - Intergenic
902483689 1:16727313-16727335 GCCTCCCACGTGGGAGACCCGGG + Intergenic
902494639 1:16861949-16861971 GCCTCCCACGCGGGAGACCCGGG + Intronic
908401136 1:63774063-63774085 GCCGCCGCCGAGGGAGCCCCGGG + Exonic
913324343 1:117613639-117613661 GCAGCCCTGGACTGAAACCCAGG - Intronic
913662521 1:121016865-121016887 GCCTCCCACGCGGGAGACCCGGG - Intergenic
923506753 1:234611044-234611066 GCCGCGCTGGCCGTAGACCCCGG - Intergenic
923543582 1:234907789-234907811 GCCGGTCTCGACAGAGACCTCGG + Intergenic
1069769490 10:70888371-70888393 GCCGCCAGCGACAGAGAGCCGGG + Intronic
1072151665 10:92689650-92689672 GACGCCCTCGAGGGAAGCCCTGG - Intergenic
1072801101 10:98393011-98393033 GCCCCCCTGGACGTAGCCCCAGG + Exonic
1075999718 10:126905291-126905313 CCCGCCCTCGGCGCGGACCCTGG - Intergenic
1076683773 10:132187649-132187671 GCCGCTCTGGCCGGAGTCCCTGG + Intronic
1077037929 11:504210-504232 GCCACCCTCTAGGGAGACACGGG + Intronic
1077250205 11:1557464-1557486 GCCGCCCTGCAGGGCGACCCGGG - Exonic
1081812869 11:45923078-45923100 GCCGCCCTCGACGGAGACCCGGG + Exonic
1083878986 11:65539047-65539069 GCCGCCCTCGGCCCAGACCTCGG - Exonic
1084905460 11:72342797-72342819 GCCGCCTTCTACGGAGACTGTGG - Intronic
1084967952 11:72754079-72754101 GCAGGCCTTGACAGAGACCCTGG - Intronic
1085391535 11:76184754-76184776 GCCTCCCTGGAAGGAGCCCCTGG - Intergenic
1085690240 11:78658453-78658475 GCCGCCCCCCACTGAGGCCCAGG + Exonic
1092013742 12:5139203-5139225 GCCTCCCTGGATGGAGGCCCAGG + Intergenic
1093116710 12:15221069-15221091 GCCGCCCTGGGAGGAGAACCCGG + Intronic
1097641691 12:62191056-62191078 ACCGCCCGCGAGGGAGACGCCGG + Intronic
1101371798 12:104137785-104137807 CCCGCTCTCGACGGCGTCCCGGG - Intronic
1105277525 13:18944445-18944467 GCCCCCCGTGAGGGAGACCCTGG + Intergenic
1108689172 13:52846857-52846879 GCCGCCCGCGACCGGGACCTGGG - Exonic
1113985765 13:114314573-114314595 GCCGCCCGCGACCGCGAGCCGGG + Exonic
1118610126 14:67533298-67533320 GTCGCTCTCGCCGGAGTCCCGGG - Exonic
1122694729 14:103547076-103547098 GCCGCCCTCCACACAGCCCCTGG - Intergenic
1123044624 14:105505294-105505316 GCCGTCCTCGGAGGAGACCCTGG - Intergenic
1131054523 15:89367746-89367768 GCCTGCCTCGACGGCGTCCCGGG - Intergenic
1132410982 15:101578133-101578155 GCTGCCCAGCACGGAGACCCTGG - Intergenic
1132670851 16:1101803-1101825 GCCGCCCTCGACACAGCCCCAGG - Intergenic
1132844341 16:1993012-1993034 CCCGCCCTTCACCGAGACCCTGG + Exonic
1139446484 16:67001387-67001409 GCAGCCTTCGGGGGAGACCCAGG + Exonic
1142224740 16:88871954-88871976 GGCGCCCTGGTCGGGGACCCTGG + Intergenic
1142474376 17:180775-180797 GCCGCCCGCGCCGGAGCTCCGGG + Intronic
1143341245 17:6213045-6213067 GCCGGCCTCTGCTGAGACCCTGG + Intergenic
1145076653 17:19860890-19860912 GCCTCCCACGCAGGAGACCCAGG + Intronic
1149270139 17:54968561-54968583 GCAGCCCTGGTTGGAGACCCAGG + Exonic
1150211984 17:63446584-63446606 GCGGCCCTCGAGGCAGGCCCGGG - Intergenic
1152714300 17:81891239-81891261 GCCGCTCGCGGCGGAGACCCGGG - Intronic
1153805483 18:8705912-8705934 GCCGCCCTCGCCGGGGTCCCTGG + Intronic
1161393622 19:4033586-4033608 GCCGCCCTCCCCGGGGCCCCGGG - Intronic
1162033014 19:7925481-7925503 GCCGCCGTCGACGGGGCCCCCGG - Exonic
925790182 2:7476731-7476753 GCCTTCCTCCAGGGAGACCCAGG - Intergenic
927658430 2:24971678-24971700 GCACCCCTCGGCTGAGACCCGGG + Intronic
938058362 2:128233474-128233496 GTCGCCCCCGGCGGAGACGCGGG - Intergenic
1172880396 20:38195920-38195942 GCAGCCCACGACAGAGACACAGG + Intergenic
1175394668 20:58650323-58650345 GCGTCCCGCGACGGAGACCCGGG - Intergenic
1176249469 20:64113442-64113464 TCTGCCCACGACGGAGAGCCCGG - Intergenic
1181268129 22:21642816-21642838 TCCGCGATTGACGGAGACCCTGG + Intronic
1181395226 22:22616602-22616624 GAGGCCCTCGACGGGGTCCCAGG + Intergenic
1182288253 22:29260437-29260459 GCCGCCCACATCGGAGTCCCTGG + Exonic
1183355074 22:37354215-37354237 GCAGCCCTCGAGGGAGAGGCTGG + Intergenic
1184785675 22:46670545-46670567 GCCGCCCTCCACGGGGAGCCTGG + Intronic
1185281499 22:49971875-49971897 CCAGCCCTCCACGGAGAGCCCGG + Intergenic
1185402934 22:50627857-50627879 GCCGCCCTTCCCTGAGACCCCGG + Exonic
952644498 3:35639365-35639387 GCTGCTCTGGCCGGAGACCCCGG - Intronic
968001521 3:195209845-195209867 GCCGCCTTGGACGGAGTCTCGGG - Intronic
968008072 3:195256312-195256334 GCCACCATCGCAGGAGACCCTGG - Intronic
968611619 4:1559805-1559827 CCCACCCAAGACGGAGACCCTGG - Intergenic
968649235 4:1753857-1753879 GCCGCCACCGCCAGAGACCCAGG + Intergenic
969300233 4:6293156-6293178 GCCCCCCAGGATGGAGACCCAGG - Intronic
970350606 4:15198178-15198200 ACCGTGCTCGAGGGAGACCCTGG + Intergenic
984928260 4:184825662-184825684 GCCGCCCGCGACTCAGACACAGG + Intronic
986227504 5:5829156-5829178 GCAGCTCTCGATGTAGACCCTGG + Intergenic
988529185 5:32012258-32012280 GCTGTCCTCGCCGCAGACCCAGG - Intronic
992542204 5:77776294-77776316 GTCGCCCTCCACGGTTACCCCGG - Exonic
993901227 5:93585167-93585189 GCCGCACACGCCGCAGACCCCGG + Exonic
997291215 5:132737210-132737232 GCCGGCCTCGACAGGGACCTGGG - Intronic
1004203869 6:13574212-13574234 GCGGCCCCTGCCGGAGACCCGGG - Intergenic
1006317716 6:33300025-33300047 GCCGACCTCGTCTGCGACCCAGG + Intronic
1019464001 7:1176421-1176443 GCCTCCCTCGAAGGAGATGCCGG - Intergenic
1024883105 7:54111830-54111852 GCAGGCCTGGAAGGAGACCCAGG + Intergenic
1024965707 7:55020263-55020285 GCGGCCATCGAAGGAGAGCCTGG - Intronic
1026739335 7:72969088-72969110 GCCGCCCTTGAAGGAGCCCTCGG - Intronic
1026790360 7:73327703-73327725 GCCGCCCTTGAAGGAGCCCTCGG - Intronic
1027104396 7:75395985-75396007 GCCGCCCTTGAAGGAGCCCTCGG + Intronic
1034979751 7:155468126-155468148 CCCAGCCTCCACGGAGACCCAGG + Intergenic
1041449892 8:57994968-57994990 GCCGGGCTCAACGGAGACCCGGG - Intronic
1049599308 8:143499724-143499746 TCCACCCTCCACGGAGGCCCTGG + Intronic
1049651515 8:143771918-143771940 GCCGCCTTCGACGGGGACGTGGG + Intergenic
1049761481 8:144333783-144333805 GCGGCCCCCGACGGCGACGCCGG - Exonic
1050350895 9:4740799-4740821 GCCGCCCGGGACAGAGACCTCGG - Intronic
1062272013 9:135714132-135714154 GCCGGCCTCGGCAAAGACCCTGG + Intronic
1062364328 9:136201829-136201851 GCTGCCCACGATGGGGACCCCGG - Intronic
1185892759 X:3835446-3835468 GCCGCCCTCCAGCGGGACCCTGG - Intronic
1185897867 X:3873866-3873888 GCCGCCCTCCAGCGGGACCCTGG - Intergenic
1185902986 X:3912297-3912319 GCCGCCCTCCAGCGGGACCCTGG - Intergenic
1188683506 X:33041336-33041358 GTCGCCCTCCACGGTTACCCCGG + Intronic