ID: 1081812871

View in Genome Browser
Species Human (GRCh38)
Location 11:45923079-45923101
Sequence CCGCCCTCGACGGAGACCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 57}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812863_1081812871 4 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812854_1081812871 24 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812862_1081812871 5 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812852_1081812871 29 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812851_1081812871 30 Left 1081812851 11:45923026-45923048 CCCCGGCCCGCTCATGCCACGTG 0: 1
1: 0
2: 0
3: 5
4: 97
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812855_1081812871 23 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812865_1081812871 2 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812861_1081812871 6 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812858_1081812871 14 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812853_1081812871 28 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57
1081812864_1081812871 3 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 2
4: 57

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812871 Original CRISPR CCGCCCTCGACGGAGACCCG GGG Exonic
904710550 1:32426825-32426847 CCCCCCACCACGCAGACCCGGGG - Intergenic
905663095 1:39743565-39743587 CAGCCCTTGATGGAGACCCCAGG - Intronic
907689222 1:56645552-56645574 CCGCGCCCGCCGGAGGCCCGGGG - Intronic
915348287 1:155209057-155209079 CCGCCCTCCCCCGAGGCCCGCGG + Exonic
919861084 1:201739948-201739970 CCGCTCTCGCCTGACACCCGGGG - Intronic
1073432157 10:103493883-103493905 CCCCGCTCCACGCAGACCCGCGG + Intergenic
1075999716 10:126905290-126905312 CCGCCCTCGGCGCGGACCCTGGG - Intergenic
1081812871 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG + Exonic
1092247927 12:6873556-6873578 CAGCCCGGGACTGAGACCCGAGG - Intronic
1095743613 12:45633459-45633481 CCTCCCTCGATGGAGCCCAGAGG - Intergenic
1102044300 12:109820328-109820350 CTGCCCTAGACAGAGACCCCAGG + Intronic
1105239188 13:18595381-18595403 CAGCCCTCCTCAGAGACCCGGGG - Intergenic
1113780440 13:112973753-112973775 GCGCCCTTCAGGGAGACCCGTGG + Intronic
1113933653 13:113981849-113981871 CCGCCCTCCACAGAGGCCTGTGG - Exonic
1123492062 15:20788703-20788725 CAGCCCTCCTCAGAGACCCGGGG + Intergenic
1123548566 15:21357793-21357815 CAGCCCTCCTCAGAGACCCGGGG + Intergenic
1128240178 15:66096275-66096297 CCGCCCTCGGCAGAGACCCCAGG - Intronic
1131054521 15:89367745-89367767 CCTGCCTCGACGGCGTCCCGGGG - Intergenic
1202956900 15_KI270727v1_random:85024-85046 CAGCCCTCCTCAGAGACCCGGGG + Intergenic
1132670849 16:1101802-1101824 CCGCCCTCGACACAGCCCCAGGG - Intergenic
1142353099 16:89588691-89588713 CCGCCTCCAATGGAGACCCGCGG + Exonic
1145273318 17:21416045-21416067 TCGCCCTCCTCGGTGACCCGCGG - Exonic
1145311507 17:21703489-21703511 TCGCCCTCCTCGGTGACCCGCGG - Exonic
1150211983 17:63446583-63446605 CGGCCCTCGAGGCAGGCCCGGGG - Intergenic
1154449604 18:14463259-14463281 CAGCCCTCCTCAGAGACCCGGGG + Intergenic
1157766152 18:50298801-50298823 TGGCCCTCGGCGGAGCCCCGCGG + Intergenic
1161408002 19:4101194-4101216 CCGCCCTCCCCAGAGCCCCGGGG - Intronic
1162372911 19:10289778-10289800 CCGGCCTCCACGTAGACCCCAGG + Intergenic
1165420067 19:35718088-35718110 CCGCCCCCGCCGGCGCCCCGCGG - Exonic
1168069837 19:53943213-53943235 CCTCCCTCGACGGGGCCTCGAGG - Exonic
932058180 2:68467658-68467680 CCGCCCTCCACAGACACGCGCGG - Exonic
932112341 2:69012972-69012994 CCGCCCCCGACGCACTCCCGCGG + Intergenic
934040425 2:88123780-88123802 CCTCCCTCGAAGGAGACAGGAGG + Intronic
936370643 2:111899201-111899223 CCGCTCTGGCCGGAGTCCCGGGG + Intronic
937522535 2:122729617-122729639 CAGCCCTCAACAGAGACCCATGG + Intergenic
938481835 2:131669488-131669510 CAGCCCTCCTCAGAGACCCGGGG - Intergenic
1180092728 21:45541382-45541404 CCTCCCCCTACGGAGACCCGAGG - Intronic
1181268131 22:21642817-21642839 CCGCGATTGACGGAGACCCTGGG + Intronic
1184785677 22:46670546-46670568 CCGCCCTCCACGGGGAGCCTGGG + Intronic
1184788272 22:46682517-46682539 GCGCCCTCGTCGCAGTCCCGAGG - Intergenic
1185070048 22:48651233-48651255 CCGCCCACGACCGAGACTTGAGG - Intronic
952866833 3:37860845-37860867 CTGCCCTCGACGGACTCCCCCGG + Intergenic
961785435 3:129344257-129344279 CCCGTCTCCACGGAGACCCGAGG + Intergenic
962929094 3:140021139-140021161 CCCCCATGGACGGAGACCTGGGG - Intronic
968603670 4:1521489-1521511 CCGCCCCCGCCGGGGCCCCGTGG + Intergenic
970350608 4:15198179-15198201 CCGTGCTCGAGGGAGACCCTGGG + Intergenic
983937061 4:173509485-173509507 CCGCCCTCCAAGGAGGCCGGGGG - Intergenic
985678399 5:1243910-1243932 CAGCCATCAACGGAGAGCCGAGG + Intronic
985784421 5:1886568-1886590 CCGCCCTCCATGGGGGCCCGCGG + Intronic
997291213 5:132737209-132737231 CCGGCCTCGACAGGGACCTGGGG - Intronic
999327096 5:150650213-150650235 ACGCCCTGGAGGGAGACACGGGG - Exonic
1006788619 6:36684337-36684359 CCGGCCTCGCCGGGGCCCCGTGG - Exonic
1007629188 6:43263305-43263327 CCGCCCTCGACGGAGAGAGTCGG + Exonic
1016416912 6:143843072-143843094 GCTCCCTCTACGGAGACCAGAGG - Intronic
1020066311 7:5190658-5190680 GCGCCCTCCAGGGAGACCCTCGG + Intronic
1028417505 7:90596069-90596091 CCTCCCTCGACGAAGGCCCCTGG - Intronic
1049441953 8:142613664-142613686 CCGTCCTCGCCGGGGACCCACGG + Exonic
1049599310 8:143499725-143499747 CCACCCTCCACGGAGGCCCTGGG + Intronic
1062478287 9:136740340-136740362 CCTGCCTCGACTGAGACCCCAGG + Intronic
1203758919 EBV:1875-1897 CCGCGCTCGGCCTAGACCCGGGG + Intergenic