ID: 1081812872

View in Genome Browser
Species Human (GRCh38)
Location 11:45923080-45923102
Sequence CGCCCTCGACGGAGACCCGG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812852_1081812872 30 Left 1081812852 11:45923027-45923049 CCCGGCCCGCTCATGCCACGTGT 0: 1
1: 0
2: 0
3: 3
4: 82
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812858_1081812872 15 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812863_1081812872 5 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812855_1081812872 24 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812862_1081812872 6 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812865_1081812872 3 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812853_1081812872 29 Left 1081812853 11:45923028-45923050 CCGGCCCGCTCATGCCACGTGTC 0: 1
1: 0
2: 1
3: 4
4: 65
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812861_1081812872 7 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812854_1081812872 25 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49
1081812864_1081812872 4 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812872 Original CRISPR CGCCCTCGACGGAGACCCGG GGG Exonic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
903982712 1:27201431-27201453 CCGCCTCGAAGGTGACCCGGCGG + Intergenic
1063663184 10:8047669-8047691 CGGCAGCGACGGATACCCGGTGG - Intergenic
1072664648 10:97384566-97384588 CTGCCTGGACGGAGACCCTGAGG + Intronic
1072664684 10:97384715-97384737 CAGCCTGGACGGAGACCCTGAGG + Intronic
1076146396 10:128125963-128125985 CGCCCTCGCCAGAGCCCAGGAGG + Intronic
1076146492 10:128126298-128126320 CGCCTCTGACGGGGACCCGGTGG + Exonic
1081812872 11:45923080-45923102 CGCCCTCGACGGAGACCCGGGGG + Exonic
1091223270 11:133943437-133943459 CTCCCTCCAGGGAGACCCCGAGG + Intronic
1103951690 12:124554885-124554907 AGCCTTCGAGGGTGACCCGGAGG + Intronic
1105239187 13:18595380-18595402 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
1123492063 15:20788704-20788726 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1123548567 15:21357794-21357816 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1128240177 15:66096274-66096296 CGCCCTCGGCAGAGACCCCAGGG - Intronic
1202956901 15_KI270727v1_random:85025-85047 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1132665674 16:1080381-1080403 AGCCTTGGACGGGGACCCGGTGG - Intergenic
1132670848 16:1101801-1101823 CGCCCTCGACACAGCCCCAGGGG - Intergenic
1143053109 17:4142892-4142914 CGCCCAAGACGGAGACCCCATGG - Exonic
1144490554 17:15704753-15704775 GGCCCTCGATGGTGACCTGGAGG + Intronic
1147150393 17:38510668-38510690 CGCTGTCGCCCGAGACCCGGCGG + Exonic
1148059923 17:44829699-44829721 CGCACTCGGCGGCGCCCCGGCGG - Intronic
1150211982 17:63446582-63446604 GGCCCTCGAGGCAGGCCCGGGGG - Intergenic
1152424273 17:80210496-80210518 CGCCCCCGACGGCGTCCTGGAGG - Exonic
1154449605 18:14463260-14463282 AGCCCTCCTCAGAGACCCGGGGG + Intergenic
1156337753 18:36186073-36186095 CCCCCTGGCCGGAGACCCAGGGG - Intergenic
1158959704 18:62579421-62579443 CGCCCTTGACGCAGTCCTGGTGG + Intronic
1160730626 19:640219-640241 CGCCCGCGGGGGAGTCCCGGAGG + Intronic
1161408001 19:4101193-4101215 CGCCCTCCCCAGAGCCCCGGGGG - Intronic
1162731380 19:12721090-12721112 CGCCCTCGGCGGACAGGCGGAGG + Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167002824 19:46756026-46756048 CGCCCTGGACGGAGATGCTGTGG + Exonic
1168301303 19:55406818-55406840 GGCCCTCGATGGTGACCTGGAGG + Exonic
927156538 2:20224435-20224457 GGCCCCCGTCGGTGACCCGGGGG - Intronic
936370644 2:111899202-111899224 CGCTCTGGCCGGAGTCCCGGGGG + Intronic
938481834 2:131669487-131669509 AGCCCTCCTCAGAGACCCGGGGG - Intergenic
1184785678 22:46670547-46670569 CGCCCTCCACGGGGAGCCTGGGG + Intronic
1184788271 22:46682516-46682538 CGCCCTCGTCGCAGTCCCGAGGG - Intergenic
961340374 3:126213282-126213304 CGGCCTGGAGGGAGACCCGGCGG + Intergenic
968410713 4:387288-387310 CTCCCTCGGAGGAGACCTGGAGG - Intergenic
985493602 5:192895-192917 CTCCCTCGAGGGAGACTGGGAGG - Intronic
999327095 5:150650212-150650234 CGCCCTGGAGGGAGACACGGGGG - Exonic
1006140750 6:31928132-31928154 CGCCTTAGACAGAGACCGGGTGG - Exonic
1016416911 6:143843071-143843093 CTCCCTCTACGGAGACCAGAGGG - Intronic
1019288629 7:236254-236276 CGTCCTCGGCGGAGACCAGCAGG - Intronic
1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG + Intronic
1029124492 7:98287196-98287218 CGCTCTCCCCAGAGACCCGGGGG + Intronic
1032578573 7:133081895-133081917 CCGCCTCGAAGGTGACCCGGCGG + Exonic
1034159593 7:148983234-148983256 CCCCCTCCACGGGGAACCGGGGG + Intergenic
1049599311 8:143499726-143499748 CACCCTCCACGGAGGCCCTGGGG + Intronic
1057509849 9:95669254-95669276 CTCCCTGGAAGGAGACCCTGAGG + Intergenic
1062461927 9:136665863-136665885 CGCCCTCGACCCAGCCCGGGCGG - Intronic
1062656063 9:137605195-137605217 GCCCCCCGACGGAGACGCGGCGG + Intergenic