ID: 1081812875

View in Genome Browser
Species Human (GRCh38)
Location 11:45923084-45923106
Sequence CTCGACGGAGACCCGGGGGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 76}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812855_1081812875 28 Left 1081812855 11:45923033-45923055 CCGCTCATGCCACGTGTCCCCCC 0: 1
1: 0
2: 1
3: 10
4: 160
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812863_1081812875 9 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812864_1081812875 8 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812858_1081812875 19 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812865_1081812875 7 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812854_1081812875 29 Left 1081812854 11:45923032-45923054 CCCGCTCATGCCACGTGTCCCCC 0: 1
1: 0
2: 0
3: 13
4: 140
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812861_1081812875 11 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76
1081812862_1081812875 10 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG 0: 1
1: 0
2: 0
3: 7
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812875 Original CRISPR CTCGACGGAGACCCGGGGGC CGG Exonic
900131346 1:1088503-1088525 CCCGAGAGAGACCCGGGGGAGGG - Intronic
901110013 1:6786081-6786103 CCCGCCGGAGAGCAGGGGGCCGG - Intronic
904822782 1:33256313-33256335 CTCGCGGGAGCCCCCGGGGCCGG + Intergenic
905033744 1:34904341-34904363 CGGGATGGATACCCGGGGGCCGG - Exonic
907430247 1:54406964-54406986 CGAGAGGGAGGCCCGGGGGCGGG - Intronic
922472930 1:225887839-225887861 CTCGACGGTCACCCGGGCCCGGG + Exonic
1063705919 10:8430695-8430717 CTGGGAGGAGACCTGGGGGCTGG + Intergenic
1065100451 10:22325818-22325840 CGCGGCGGACGCCCGGGGGCCGG - Intronic
1065188718 10:23192380-23192402 CTCCAGGGAGGCCCGGGGGCGGG + Exonic
1066464340 10:35640024-35640046 GTGGACGGCGACCCGGTGGCGGG - Exonic
1073432162 10:103493888-103493910 CTCCACGCAGACCCGCGGGCGGG + Intergenic
1074012093 10:109492512-109492534 CTCCAGGGAGTCCTGGGGGCTGG + Intergenic
1076348883 10:129801098-129801120 CTGGATGGAGTCCCTGGGGCTGG + Intergenic
1077418959 11:2440564-2440586 CTCCACAGAGACCCTGGAGCAGG - Intergenic
1081812875 11:45923084-45923106 CTCGACGGAGACCCGGGGGCCGG + Exonic
1083243126 11:61404422-61404444 CTCTATGGAGACCAGGGGCCTGG + Exonic
1084967949 11:72754073-72754095 CTTGACAGAGACCCTGGGTCAGG - Intronic
1096184470 12:49569308-49569330 CTGAACCGAGACCCGGGGGCCGG - Intronic
1097076353 12:56397511-56397533 CTTGAGGGAGAGCCGGGAGCAGG - Intergenic
1098973592 12:76879321-76879343 CTCCAGGGAGGCCCGGCGGCGGG + Intergenic
1100391724 12:94150040-94150062 CTCCGCGGCGCCCCGGGGGCAGG - Intronic
1102890252 12:116553025-116553047 TTTGATGGAGACACGGGGGCTGG + Intergenic
1103474817 12:121210441-121210463 CGCGCCGGGGCCCCGGGGGCGGG + Intronic
1106480357 13:30133055-30133077 AGCGACGGGGACCCGGAGGCAGG + Intergenic
1114519121 14:23321782-23321804 GTCGAGGGTGACCCGGGGGACGG + Exonic
1121001283 14:90453738-90453760 GTGGAGGGAGGCCCGGGGGCAGG - Intergenic
1121561233 14:94877574-94877596 CTCCAAGGAGACCCGGTGGCGGG - Intergenic
1124364438 15:29062138-29062160 CTCCACTGAGGCCTGGGGGCTGG - Intronic
1131753664 15:95537393-95537415 CTCCACAGATACCCGGGAGCTGG + Intergenic
1132559940 16:589064-589086 CTGGACGGGGACCCAGGGCCCGG - Intergenic
1132664779 16:1076347-1076369 CTCCACGCAGACCCCGGGGTGGG - Intergenic
1132670845 16:1101797-1101819 CTCGACACAGCCCCAGGGGCTGG - Intergenic
1135327041 16:21533137-21533159 CCTGAGGGACACCCGGGGGCTGG - Intergenic
1140479788 16:75256438-75256460 GTCCCCAGAGACCCGGGGGCAGG + Intronic
1142239979 16:88940691-88940713 CGTGACGGAGACCCGGGAGTGGG - Intronic
1145001557 17:19308633-19308655 CTGCACGGAGACCCGGGAGGAGG + Intronic
1145969730 17:28949902-28949924 CCCGGCGGACACCTGGGGGCGGG + Intronic
1148344532 17:46894653-46894675 CCCCACGGAGACCTGGTGGCAGG - Intergenic
1152386531 17:79978085-79978107 CTCGACCGTGACCATGGGGCAGG - Intronic
1152577257 17:81148304-81148326 GTGGACGGAGACCCCAGGGCAGG - Intronic
1155276141 18:24189452-24189474 CTCCACTGACAGCCGGGGGCTGG + Intronic
1160452381 18:78974255-78974277 CTCGACGGGGCCTCGGGGCCCGG + Intergenic
1160720448 19:594814-594836 CTCCACGCAGACCAGAGGGCAGG - Intronic
1161316252 19:3618978-3619000 CTCCATGTAGACCTGGGGGCAGG + Exonic
1161407998 19:4101189-4101211 CTCCCCAGAGCCCCGGGGGCCGG - Intronic
1161619651 19:5291371-5291393 CTCGACTGAGAGCCGGGCTCTGG - Intronic
1166375473 19:42324787-42324809 CTCGAAGGGGGCCAGGGGGCCGG - Exonic
1167002708 19:46755584-46755606 CAGGACGGTGACACGGGGGCCGG - Exonic
1168267824 19:55231912-55231934 CTCCCCGGAGACTCGGGGGCTGG + Exonic
1168337702 19:55605711-55605733 CCCGGCGGAGACCCCGGCGCCGG + Intronic
925073257 2:987915-987937 CTGGGCGCAGACCCAGGGGCTGG - Intronic
937321612 2:120964283-120964305 CTGGAAGGAGACCTGGTGGCTGG + Intronic
939153939 2:138502174-138502196 GTCTACGGAGAGCCGGGGGAGGG - Intronic
948918710 2:241051614-241051636 CTCGACGAAGCCCTGGGGCCTGG - Intronic
1169084993 20:2821011-2821033 CTAGACCAAGGCCCGGGGGCAGG + Intergenic
1170533267 20:17315508-17315530 TCCGACAGAGACCCGGGAGCTGG - Intronic
1174447835 20:50602359-50602381 CTGGCAGGAGACCTGGGGGCAGG + Exonic
1176057314 20:63155567-63155589 CTGGACAGAGACTCTGGGGCAGG - Intergenic
1179461714 21:41539802-41539824 CTGGACGGAGACCAGCAGGCAGG + Intergenic
1180117785 21:45723258-45723280 CTCGAGGGAGGCTCTGGGGCAGG + Intronic
1183586433 22:38755694-38755716 CCCGACGGTGACCCGGGGTCAGG + Intronic
1184004767 22:41699903-41699925 CTCCACGGAGGCCCGCAGGCCGG - Intronic
954331940 3:49895869-49895891 ATCTACGCAGACCTGGGGGCAGG + Exonic
956780606 3:72600147-72600169 CTCGACAGAGACTCAGGTGCAGG + Intergenic
968090115 3:195894160-195894182 CTGGAAGGAGACCCAGGGACCGG + Intronic
968323453 3:197791566-197791588 CCCGTCGGAGACCCGGCGCCGGG + Intronic
969619880 4:8273599-8273621 CTCAGGAGAGACCCGGGGGCTGG - Intronic
973641934 4:52911886-52911908 CTCGAGGGAGACCAGAAGGCAGG + Intronic
985537445 5:473166-473188 CCCGAGGGCGAGCCGGGGGCGGG - Intergenic
990978141 5:61576979-61577001 CTAGATGGAGACCCTGAGGCGGG + Intergenic
995860877 5:116639247-116639269 GGCAAAGGAGACCCGGGGGCAGG - Intergenic
996785079 5:127229420-127229442 CGCGCCGGCGACCCTGGGGCGGG + Intergenic
997291211 5:132737204-132737226 CTCGACAGGGACCTGGGGTCAGG - Intronic
998449436 5:142222895-142222917 CACGACGGAGAGCTGGGGGTGGG - Intergenic
998957553 5:147453418-147453440 AGGGACGGAGACCCGGGGTCCGG - Intronic
999188795 5:149731463-149731485 CTCGGAGGAGCCCCGGGTGCTGG + Intronic
1012550551 6:100461354-100461376 CTTGGTGTAGACCCGGGGGCAGG - Intronic
1017842346 6:158232200-158232222 CTCGGCCGAGACGCGGGGGGAGG + Intergenic
1019710741 7:2517114-2517136 CTAGAGGGAGACCTGGGGTCTGG + Intronic
1019962544 7:4472998-4473020 CTCGACGGAGACTGGATGGCTGG + Intergenic
1024312019 7:47978420-47978442 CTCCACGGAGACCGTGAGGCAGG + Exonic
1034159598 7:148983238-148983260 CTCCACGGGGAACCGGGGGTGGG + Intergenic
1050304987 9:4298244-4298266 CTCGGCGGGGACCGGGGGGCCGG - Intronic
1057312727 9:93952088-93952110 CTCGGCGGAAACCCGCGAGCCGG - Exonic