ID: 1081812876

View in Genome Browser
Species Human (GRCh38)
Location 11:45923090-45923112
Sequence GGAGACCCGGGGGCCGGCCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 482
Summary {0: 1, 1: 0, 2: 3, 3: 38, 4: 440}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812863_1081812876 15 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812861_1081812876 17 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812862_1081812876 16 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812867_1081812876 -9 Left 1081812867 11:45923076-45923098 CCGCCGCCCTCGACGGAGACCCG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812865_1081812876 13 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812858_1081812876 25 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440
1081812864_1081812876 14 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG 0: 1
1: 0
2: 3
3: 38
4: 440

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812876 Original CRISPR GGAGACCCGGGGGCCGGCCC CGG Exonic
900192292 1:1356600-1356622 GGACCCCCGGGGGCTGGGCCTGG + Intronic
900634845 1:3657943-3657965 CGAGACCCGGGCCCCAGCCCTGG + Intronic
901110009 1:6786075-6786097 GGAGAGCAGGGGGCCGGCGAGGG - Intronic
901132630 1:6971783-6971805 TGAGACCCGGGGGCGGCCACAGG - Intronic
901138055 1:7010270-7010292 GGCGGCCCAGGAGCCGGCCCTGG - Intronic
901242405 1:7703297-7703319 GGTGACCCGGGGGGCGGGCGAGG + Intronic
901493038 1:9606283-9606305 GGGGACCCTGGGGAAGGCCCCGG - Intronic
901551301 1:9997693-9997715 GCAGACTCGGGGTCCGGCCGGGG + Intronic
901703847 1:11059511-11059533 GGAGACCCCGGGTCCCACCCCGG - Intronic
902304116 1:15524288-15524310 CGTGACGCGGGGGCAGGCCCTGG - Exonic
902623482 1:17663835-17663857 GGAGACTTGGGGTCTGGCCCTGG - Intronic
903138721 1:21326065-21326087 GGGGACCAGGGGGCTGGGCCTGG + Intronic
903233968 1:21937565-21937587 GGGGACCGGGGGCCCGGGCCCGG + Intergenic
904254000 1:29243178-29243200 TGAGCCCCCGGGCCCGGCCCAGG + Intronic
904931134 1:34088294-34088316 GGTGACCCGGAGGCCAGCCAGGG - Intronic
905033742 1:34904335-34904357 GGATACCCGGGGGCCGGGCCAGG - Exonic
905301731 1:36990341-36990363 GGAGACCCAGATGGCGGCCCAGG - Intronic
905482553 1:38271498-38271520 GGAGGCCGGGGGGACAGCCCTGG - Intergenic
905657192 1:39692376-39692398 GCAGCCCAGGCGGCCGGCCCGGG - Intronic
905912176 1:41662480-41662502 GGGGACCCCGCCGCCGGCCCGGG + Intronic
909357527 1:74726489-74726511 GGAGGCCCTGGGCCCGGCCCAGG + Intronic
910623700 1:89284310-89284332 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
911242078 1:95478165-95478187 GGAGACCCTGGGCCCAGCCCAGG - Intergenic
912279488 1:108297968-108297990 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
912288738 1:108396389-108396411 GGGGACCCTGGGCCTGGCCCAGG - Intronic
912955554 1:114152623-114152645 GGCGACGTGGCGGCCGGCCCAGG - Exonic
913186512 1:116374016-116374038 GGAGGCCCGGGAGGAGGCCCCGG - Exonic
913222132 1:116667857-116667879 GGAGACGCGAGTCCCGGCCCCGG + Intergenic
915345422 1:155194739-155194761 CGAGACCCTGGGGCAGGCGCTGG + Intergenic
915559224 1:156676759-156676781 GGAGGCCCGCGGGGCGGCGCGGG + Exonic
918116784 1:181504626-181504648 GGAGCCCTGGGGGCCTGGCCTGG - Intronic
918480782 1:184974538-184974560 GATGATCCGTGGGCCGGCCCGGG + Exonic
921773526 1:219071407-219071429 GGGGACCCCGGGCCCAGCCCAGG - Intergenic
922739601 1:228007741-228007763 GGCGCACTGGGGGCCGGCCCTGG + Intronic
922937703 1:229434232-229434254 GGGGACCCGGGCGGGGGCCCAGG - Intergenic
922998701 1:229987678-229987700 GGAGCCCCGGGAGTGGGCCCAGG - Intergenic
923461177 1:234210963-234210985 GGGGACCCTGGGCCTGGCCCAGG - Intronic
923543616 1:234908058-234908080 GGAGACACAGGTCCCGGCCCAGG + Intergenic
924042614 1:239998068-239998090 GACGCCCCGGGGACCGGCCCGGG - Intergenic
924289715 1:242524702-242524724 GCCGCCCCGGGAGCCGGCCCGGG - Intergenic
1063154022 10:3361873-3361895 GGAGCCCCTGGGCCTGGCCCAGG - Intergenic
1063979855 10:11444585-11444607 GGAGACGGGGGGGCGGGGCCAGG - Intergenic
1064392455 10:14953827-14953849 GGACAGGAGGGGGCCGGCCCTGG - Intronic
1065110618 10:22436802-22436824 GGAGACCCGGAGGCCGTCCCAGG - Intronic
1065343005 10:24723754-24723776 CGAGAGCCCGGGGCCGGCCGGGG - Intergenic
1066235388 10:33480452-33480474 GGAGTGCCGGGGGACGGCGCTGG - Intergenic
1067038014 10:42933473-42933495 GAAGAGCCGAGGGCAGGCCCTGG + Intergenic
1067062923 10:43087208-43087230 GGAGAGATGGGGCCCGGCCCTGG - Intronic
1067549102 10:47220996-47221018 GGAGACCCAGGGCCTGGCCCTGG - Intergenic
1067960193 10:50839536-50839558 GGAGATCTGGGGTCCAGCCCAGG - Intronic
1070771468 10:79084944-79084966 GGAGACCCAGGGGCCTGTGCAGG - Intronic
1072368933 10:94744498-94744520 GGAGACCCTGGGCCCAGCCCAGG - Intronic
1073076773 10:100829338-100829360 GGAGACAGGGCGGCCGGGCCAGG - Exonic
1073249827 10:102114648-102114670 GGGGGCCAGGGGGCCGGCCTGGG + Intronic
1073336455 10:102714097-102714119 GGAGACCCGAGGGTGGGCCCTGG - Intronic
1073880586 10:107975275-107975297 GGAGACACTGGGCCTGGCCCAGG + Intergenic
1075237291 10:120742415-120742437 GGAGACCCAGGGGCTGGTGCAGG - Intergenic
1076594615 10:131617885-131617907 GGGGACCAGGGGGCCAGGCCTGG + Intergenic
1076599387 10:131647098-131647120 GGAGAGCCGGCCGCTGGCCCAGG + Intergenic
1076682740 10:132182412-132182434 GGAGACCCGGGACGCAGCCCGGG + Exonic
1076722157 10:132397415-132397437 GGAGACCCGGGACCCGCCTCCGG + Intronic
1076814850 10:132909632-132909654 GGAGCTCATGGGGCCGGCCCTGG + Intronic
1077040414 11:518735-518757 GGACGCCCAGGAGCCGGCCCCGG + Intergenic
1077155482 11:1089134-1089156 GGAGGCCGGGGGTCCAGCCCAGG - Intergenic
1077164693 11:1129762-1129784 GGAGATCAGGGGACAGGCCCAGG - Intergenic
1077322275 11:1947678-1947700 GGTGGCCCGGGGTCAGGCCCGGG + Intronic
1077332356 11:1989206-1989228 GGAGACCCGGGGCTGGGACCAGG - Intergenic
1077378026 11:2214760-2214782 GGAGCCCCGGGGCTCGGGCCTGG - Intergenic
1077383931 11:2260226-2260248 GGAGACCTGGCAGGCGGCCCTGG + Intergenic
1077489756 11:2855356-2855378 GGAGTCTCTGGGGTCGGCCCAGG - Intergenic
1077602015 11:3580847-3580869 GGAGGCTCCGTGGCCGGCCCCGG - Intergenic
1077919845 11:6633748-6633770 GGGGACCTGGGGGAAGGCCCCGG + Intronic
1078190605 11:9090686-9090708 GGAGTGCAGGGGGCCGGCCATGG - Intronic
1078246108 11:9574168-9574190 GGGCTGCCGGGGGCCGGCCCGGG - Exonic
1078664455 11:13313200-13313222 GGAGAACCGGGAGCCGACCCAGG - Intronic
1081207624 11:40293445-40293467 GGGGACCCGGGGGCTGGCAGGGG - Exonic
1081632146 11:44696427-44696449 GCAGACCCTGGGACCGGCCGAGG + Intergenic
1081812876 11:45923090-45923112 GGAGACCCGGGGGCCGGCCCCGG + Exonic
1082803645 11:57432609-57432631 GGAGACCCAGGGTCCAGTCCTGG + Intergenic
1082889687 11:58125664-58125686 GGAGTCCCAGGGGCTGTCCCAGG - Intronic
1083904858 11:65662837-65662859 GGGGTCCCGGGGGCGGGGCCGGG + Exonic
1084151438 11:67289570-67289592 GGGGACCCGGGGGAAGGGCCGGG - Intronic
1084257922 11:67955393-67955415 GGAGGCTCCGTGGCCGGCCCCGG - Intergenic
1084499239 11:69525130-69525152 GCAGACATGGGGGCAGGCCCAGG - Intergenic
1084524428 11:69686891-69686913 TGAGACTCGGGGGACAGCCCAGG - Intergenic
1084560611 11:69903547-69903569 GGTGACCCGTGGGCAGCCCCCGG + Intergenic
1084814839 11:71639844-71639866 GGAGGCTCCGTGGCCGGCCCCGG + Intergenic
1085720660 11:78909829-78909851 AGAGACACTGGGGCAGGCCCAGG + Intronic
1089257915 11:117203701-117203723 TGAGAGACGGGGGCAGGCCCTGG + Intronic
1089273287 11:117315935-117315957 CCGGACCCGGGGGCTGGCCCAGG - Exonic
1089479036 11:118790788-118790810 GGAGCCCCCCGGGCCGGCTCTGG - Intronic
1089525659 11:119094929-119094951 GGAGGCCTGGCGGCCGGCCGCGG + Exonic
1089619094 11:119712345-119712367 GGAGACTCGGGGGCCTGAACTGG - Intronic
1202805293 11_KI270721v1_random:2991-3013 GGTGGCCCGGGGTCAGGCCCGGG + Intergenic
1202815337 11_KI270721v1_random:44382-44404 GGAGACCCGGGGCTGGGACCAGG - Intergenic
1092428159 12:8390190-8390212 GGAGGCCCCGTGGCCTGCCCTGG - Intergenic
1092860816 12:12717631-12717653 GGAGACTCGGCGGCCGGGCCGGG + Exonic
1094494561 12:30981251-30981273 GGAGGGCCGGGTGCTGGCCCTGG - Intronic
1096156098 12:49342339-49342361 GGAGCTCCTGGGCCCGGCCCGGG + Intergenic
1096566059 12:52480278-52480300 GGGGACCCTGGGCCCAGCCCAGG - Intergenic
1096575343 12:52549251-52549273 TGAGTCCCGGGGGCTGGCCTGGG - Intronic
1096774375 12:53955269-53955291 CGCGACCCGGGAGCCGGGCCCGG + Exonic
1096788433 12:54030946-54030968 GGAGCCCAGGCGCCCGGCCCCGG + Intronic
1097404862 12:59177102-59177124 GTGGACCCTGGGCCCGGCCCAGG + Intergenic
1097990257 12:65825586-65825608 GGAGCCGCGGCGGGCGGCCCGGG + Intronic
1100329301 12:93570233-93570255 GTAGACCCGGCGGCCCGCCCGGG - Intronic
1101910529 12:108857560-108857582 GGAGGCCCCGGGCCCGGCCCGGG - Exonic
1102027067 12:109719698-109719720 GGAGACCCGGGAGCATGACCAGG + Intronic
1102253184 12:111401342-111401364 GGAGGCCCGGGGACCTGGCCTGG - Intergenic
1103911793 12:124356002-124356024 GGAGACCCAGGGGCCAGGTCAGG - Intronic
1104585577 12:130045578-130045600 GGAGCCCCGGAGGGCAGCCCAGG - Intergenic
1108724351 13:53163809-53163831 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
1110705944 13:78602184-78602206 GGCGGCCCGGGCGGCGGCCCCGG - Exonic
1111307496 13:86434413-86434435 GGAGACCCTGGGCCAGGCCCAGG - Intergenic
1112050710 13:95642057-95642079 GGCGGCCCGGGAGGCGGCCCAGG - Exonic
1113254782 13:108495496-108495518 GGAGACCCGGAGGGCTGCCCCGG + Intergenic
1113864447 13:113512006-113512028 GGAGTCGCGGGGGCCGGGACTGG + Intronic
1113864480 13:113512154-113512176 GGAGTCGCGGGGGCCGGGACTGG + Intronic
1113864497 13:113512227-113512249 GGAGTCGCGGGGGCCGGGACTGG + Intronic
1113942814 13:114027206-114027228 CGAGCCCCGCCGGCCGGCCCTGG - Intronic
1114269511 14:21092275-21092297 GCAGGCCCGGAGGCAGGCCCCGG + Exonic
1115007178 14:28499437-28499459 GGGGACCCTGGGCCCAGCCCAGG + Intergenic
1118350945 14:64972190-64972212 GCAGCCGCGGGGGCCGGGCCCGG - Intronic
1118697402 14:68398159-68398181 GGAGAGCTGGGCCCCGGCCCAGG - Intronic
1119046416 14:71321447-71321469 GGAGACCCGCGTCCCGGTCCGGG + Intronic
1119219224 14:72893071-72893093 GGACTCGCGGGGGCCAGCCCCGG - Intronic
1121453284 14:94022974-94022996 GCAGAGCTGGGGGCTGGCCCTGG - Intergenic
1121595198 14:95157130-95157152 GGAGGCCCGCGTGCCGGCCATGG - Intronic
1122362685 14:101176633-101176655 GGGGAGCCGGGGGCCTGCCTGGG + Intergenic
1122544803 14:102516615-102516637 GGAGACCGGAGGGCCTGGCCCGG + Intergenic
1122634674 14:103124389-103124411 GGAGACCTGGGGCGAGGCCCAGG + Intronic
1122908701 14:104815826-104815848 GGAGGCCCAGGAGCCGGCGCCGG - Intergenic
1122960518 14:105091875-105091897 GGAGGCCAGGAGGCAGGCCCAGG + Intergenic
1202857970 14_GL000225v1_random:63449-63471 GGAGATCCCAGAGCCGGCCCAGG - Intergenic
1125903650 15:43370989-43371011 GGAGAGCCGGGGCCGGGGCCGGG - Intronic
1126736217 15:51734422-51734444 GGAGACCTGGTTGCCAGCCCTGG - Intronic
1127103251 15:55588258-55588280 GGAGGCTCGCGGCCCGGCCCTGG + Intronic
1127995641 15:64151917-64151939 GGGGACCCGGGGCCCGGGCCTGG + Intronic
1128944569 15:71811869-71811891 GGTGAGGCGGGGGCTGGCCCGGG + Exonic
1130292384 15:82614078-82614100 GCAGCCCCTGGGGCCGTCCCAGG - Intronic
1131052760 15:89359312-89359334 GGAGCCACGGAGGCCGGCGCGGG - Intergenic
1132110813 15:99100615-99100637 GGAGACCAGAGGGGCGGCTCTGG - Intronic
1132502907 16:292528-292550 GGAGGCCCGGGAGGCGGGCCTGG + Intronic
1132516482 16:368448-368470 GGGGACTCGTGGCCCGGCCCTGG - Intronic
1132641901 16:981861-981883 GCAGCCCCGGGCGCCGGCCCCGG + Exonic
1132676128 16:1121951-1121973 GGAGAGCTGGGGACAGGCCCAGG - Intergenic
1132844374 16:1993112-1993134 GGAGACCCTGGGGCCTGCGTTGG - Exonic
1133149272 16:3814870-3814892 GGAGAGGCTGGGGCTGGCCCTGG - Intronic
1133370075 16:5240180-5240202 GGAGGCTCCGTGGCCGGCCCCGG + Intergenic
1133784302 16:8963183-8963205 TGAGGCCCGAGGGCCGGCCGCGG - Intronic
1133802188 16:9092524-9092546 GGACACCGGGTGGCCGGGCCCGG - Intronic
1134094556 16:11411037-11411059 GGGGCCACGGGGGCTGGCCCAGG + Intronic
1135436294 16:22428841-22428863 GGAGAGCCGGCAGCCGGCCCAGG - Intronic
1136236885 16:28919807-28919829 GGAGTCCAGGGGGTAGGCCCGGG + Exonic
1136247668 16:28984935-28984957 GGAGGCCCGGGAGCCACCCCAGG - Intronic
1137606372 16:49789431-49789453 GGGGTCCTGGGGGCTGGCCCAGG - Intronic
1137608693 16:49804507-49804529 GGAGACCTGGGAACAGGCCCAGG + Intronic
1137617424 16:49855991-49856013 GGAGGCCCGGGGGGCGCGCCGGG + Intronic
1138179873 16:54933688-54933710 GGCCACCCGGGGCCCGGGCCAGG + Exonic
1138591274 16:58000788-58000810 GGGGACCCCGTGGCCGGGCCAGG + Intronic
1139576019 16:67842517-67842539 GGAGGCCGGTGGGCCGGGCCGGG + Exonic
1141658865 16:85430852-85430874 TGAGACCCCGGGGCAGGGCCCGG - Intergenic
1141776680 16:86127766-86127788 GGAGAGCTGGGGGCAGACCCTGG + Intergenic
1142025781 16:87812766-87812788 GGAGACCTTGGGGCCGCCGCTGG - Intergenic
1142045509 16:87922674-87922696 GGAGAGCCGGCAGCTGGCCCAGG - Intronic
1142125225 16:88406856-88406878 GGAGACCTGGGGGCCGACGGGGG - Intergenic
1142472217 17:170782-170804 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472251 17:170878-170900 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472309 17:171042-171064 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472332 17:171106-171128 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472344 17:171138-171160 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472404 17:171304-171326 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472416 17:171336-171358 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472451 17:171434-171456 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472486 17:171532-171554 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472498 17:171564-171586 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472522 17:171630-171652 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472545 17:171694-171716 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472580 17:171792-171814 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472615 17:171890-171912 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472627 17:171922-171944 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142472639 17:171954-171976 GGAGCACCAGGGGCCGGGCCAGG + Intronic
1142586870 17:979473-979495 GGGGACGCGGCGGCCGGGCCGGG - Exonic
1142611672 17:1111853-1111875 GGAGACCCAGTGGCCGGGGCAGG - Intronic
1142712492 17:1730985-1731007 GAGGACCTGAGGGCCGGCCCGGG + Intronic
1144547881 17:16215079-16215101 GGACACCTCGGGGCCAGCCCCGG + Intronic
1144965844 17:19076892-19076914 AAAGATCCGGGGGCCGGCTCTGG - Intergenic
1144982124 17:19175290-19175312 AAAGATCCGGGGGCCGGCTCTGG + Intergenic
1144986099 17:19202949-19202971 AAAGATCCGGGGGCCGGCTCTGG - Intergenic
1145254856 17:21316879-21316901 GAAGCCCCGAGGGCCGGGCCAGG - Intergenic
1145321744 17:21771086-21771108 GAAGCCCCGAGGGCCGGGCCAGG + Intergenic
1146271595 17:31488723-31488745 GGAGTCCTCGGGGCCAGCCCAGG + Intronic
1147211746 17:38875895-38875917 GGAGGCCAGGAGGCAGGCCCAGG - Intronic
1148048674 17:44758939-44758961 GGAGAGCGGAGGGCGGGCCCTGG + Intergenic
1148108636 17:45132425-45132447 GCAGACCCCGGGCCCGGCCCCGG - Exonic
1148390563 17:47269139-47269161 GGAGGCCCTGGGCCCAGCCCAGG + Intronic
1149260677 17:54876920-54876942 GGAGACCCTGGCCCTGGCCCAGG - Intergenic
1149366686 17:55952372-55952394 GGGGACCCTGGGCCCGACCCAGG - Intergenic
1151707632 17:75779223-75779245 GCAGCCCTGGGGGGCGGCCCGGG - Intronic
1151875992 17:76868597-76868619 GGGGACCGGGGCGCGGGCCCGGG + Intronic
1152421469 17:80195580-80195602 GGAGACCCGGGAGCCCTGCCGGG + Exonic
1152567843 17:81108095-81108117 GGAGTCCCAGGGGCCCGCCCAGG + Intronic
1152734694 17:81991657-81991679 GGAGAGCCTGGGGCAGGCTCCGG - Intronic
1152879442 17:82806893-82806915 GCAGACCCAGGGCCCCGCCCGGG - Intronic
1153457504 18:5296187-5296209 GGAGACTACGGGGCCGCCCCCGG + Intronic
1154388480 18:13916743-13916765 GGAAAACCGGTGGCCAGCCCTGG + Intergenic
1155047534 18:22115860-22115882 CGAGACCCGGGTGCAGGCACAGG + Intergenic
1155910284 18:31498022-31498044 ATGGAGCCGGGGGCCGGCCCGGG - Exonic
1156275564 18:35580959-35580981 CGAGACCCGGGTGCCTGCCCCGG + Intergenic
1156350242 18:36297035-36297057 GGAGCCCCGGGGTCCAGGCCCGG + Intergenic
1156467323 18:37356029-37356051 AGAGACCCTGGGGCCAGGCCAGG - Intronic
1156475249 18:37401911-37401933 GAAGACCTGGGGTCTGGCCCAGG - Intronic
1156607246 18:38680549-38680571 GGAGACCCTGAGCCTGGCCCAGG + Intergenic
1157568638 18:48697631-48697653 GGATACCCGGGTTCCTGCCCTGG - Intronic
1158222025 18:55160140-55160162 GTGGACCCTGGGCCCGGCCCAGG - Intergenic
1158516856 18:58138018-58138040 GCAGACCCGGGGCCCTGCCCAGG - Intronic
1160592496 18:79952028-79952050 GGAGACCCGGGGACCCGGCTCGG + Intergenic
1160768866 19:821636-821658 GGAGACACGGTGGCCGGCGCCGG + Intronic
1160831049 19:1104982-1105004 GGAGACCCGGAGGCCGGGAGAGG - Intronic
1160875847 19:1295900-1295922 GGGGACGCGGGGGCGGGGCCAGG + Intronic
1160909359 19:1467705-1467727 GGGCGCTCGGGGGCCGGCCCAGG - Exonic
1161007845 19:1945260-1945282 GGGGAGCCTGGGGCCAGCCCGGG - Intronic
1161065567 19:2235834-2235856 GGAGACACGGGCGCCGGGACGGG + Intronic
1161172519 19:2820089-2820111 GGAGCCGCGCGCGCCGGCCCAGG - Exonic
1161175805 19:2841657-2841679 AGGGACGCGGGGGGCGGCCCCGG + Intronic
1161234409 19:3190723-3190745 GGGGGGCCGGGGGCGGGCCCCGG - Intronic
1161285128 19:3464611-3464633 TGAGACCCGGAGACCTGCCCTGG - Intronic
1161511529 19:4674948-4674970 GGAGCCCGGGGGGCCAGTCCAGG + Intergenic
1161800455 19:6414593-6414615 GGGGACGCGGGGAGCGGCCCAGG - Intronic
1161865249 19:6828454-6828476 GGAGAACCTGCGGCTGGCCCTGG + Exonic
1161959548 19:7516194-7516216 GGGGAGCCGGCGGCCGGCGCGGG + Exonic
1161984822 19:7647398-7647420 GATGAGCCGGGGGCCCGCCCGGG - Exonic
1162100421 19:8335484-8335506 GGAGCCCCGAGGGCGCGCCCTGG + Exonic
1162268983 19:9598727-9598749 GAAGAACCAGGGGCCGCCCCTGG + Intergenic
1162461145 19:10815147-10815169 GGAGACGCGGAGCCAGGCCCTGG - Intronic
1162559241 19:11406376-11406398 GGGGATGCGGGGGCGGGCCCTGG - Intronic
1163547752 19:17949690-17949712 GGAGACGCTGGGGGCAGCCCAGG - Intergenic
1163845180 19:19634615-19634637 GCAGACCCTGGGGACGACCCTGG - Exonic
1163859309 19:19732839-19732861 GCAGACCCGGGGGCCACCGCGGG - Intronic
1165100793 19:33437482-33437504 GGAGACACGGGGGCAGGCCTGGG + Intronic
1165154230 19:33777610-33777632 GGGGACCCGGGGTCTGGGCCAGG + Intergenic
1165392276 19:35545535-35545557 AGAGAGCCCGTGGCCGGCCCTGG - Intergenic
1165447843 19:35866409-35866431 GGAGTCCCGGGGGCCAGATCTGG - Exonic
1165767843 19:38361989-38362011 GGGGACCTGGGGGCGGGGCCTGG + Intronic
1166299585 19:41906405-41906427 GGAGACCAGGGGGCTGGGCTGGG - Intronic
1166381252 19:42356415-42356437 GCAGCCCCTGGGGCAGGCCCAGG - Exonic
1166781705 19:45346606-45346628 GCAGGCCCGGCGGCTGGCCCAGG + Exonic
1167101611 19:47407316-47407338 GAGGGCCCGCGGGCCGGCCCGGG - Intronic
1167306711 19:48713976-48713998 GGATACCCCGGGGACGGCTCCGG - Exonic
1167843370 19:52139970-52139992 GGAGGCCAGGGGGCGGGGCCTGG + Intergenic
1167960943 19:53103599-53103621 AGGGACCCGGGGGCGGGCCGGGG + Intergenic
1168078167 19:53991751-53991773 GGAGCCCCGAGGGGGGGCCCTGG + Intergenic
1168267830 19:55231918-55231940 GGAGACTCGGGGGCTGGTCGGGG + Exonic
1168308979 19:55451430-55451452 GGAGACCCTGGGGGCTGCACGGG + Intergenic
926035241 2:9630911-9630933 GGAAGCCCGCGGGCCGACCCAGG + Intronic
926752702 2:16210921-16210943 GGAGACATGGGGCCTGGCCCAGG - Intergenic
927100284 2:19782921-19782943 AGGGACCCTGGGCCCGGCCCAGG - Intergenic
927667396 2:25042156-25042178 GCAGACGCGGGGGCCGGCCGCGG - Exonic
928447766 2:31348160-31348182 GCAGGCCCGGGGTCTGGCCCTGG - Intronic
929033625 2:37671568-37671590 GGAGACCCGGCCACCGGCCTGGG - Exonic
929218102 2:39437066-39437088 GGGGAGCCGGGAGCCGGCCGCGG - Exonic
935149141 2:100417753-100417775 GGAGACTCGGGATCCGGGCCTGG - Intergenic
938073926 2:128322230-128322252 GGACCCGCGGGGCCCGGCCCCGG + Intergenic
938097513 2:128473293-128473315 GGAGGCCCAGGGGCCGCCACAGG - Intergenic
940036799 2:149320365-149320387 GGTGGCCTGGGGGCCGGCGCGGG - Intergenic
941227266 2:162865305-162865327 GGAGACCCTGGACCCAGCCCAGG + Intergenic
1169196978 20:3688662-3688684 GGGGGCCTGGGGGCCTGCCCTGG - Intronic
1170156623 20:13274677-13274699 AGAGGCCCGGGGGCCGGGCGCGG - Intronic
1171389165 20:24790139-24790161 GGTGACCCAGGGGCCTGCCAGGG + Intergenic
1172039162 20:32031520-32031542 GGAGCCCCGGGTGACTGCCCCGG - Exonic
1172961734 20:38805246-38805268 GGAGGTCCAGGGGCCGGCCCTGG - Intergenic
1173448128 20:43138428-43138450 GGAGACAGGGTGGCCTGCCCAGG - Intronic
1173454004 20:43189507-43189529 TGAGACCCGGGTTCCGGCCATGG + Intronic
1173880281 20:46406566-46406588 GGAGACCCGGGAGCAGGAGCTGG - Exonic
1174346886 20:49936665-49936687 GGAGCCCCGGGGGACACCCCCGG - Intronic
1174388394 20:50200739-50200761 GGAGGCCAGGGAGCCGGGCCGGG + Intergenic
1174424688 20:50423630-50423652 GGAGACCTGGGACCGGGCCCTGG - Intergenic
1176080778 20:63272292-63272314 GGGGACCGGGGGACCGGCGCGGG - Intronic
1176140246 20:63541805-63541827 AGTGACCCGGCAGCCGGCCCAGG + Intronic
1176169428 20:63690297-63690319 GTAGCCCGGGGGGCCGGCGCTGG - Exonic
1176173666 20:63707817-63707839 CGAGGCCCGAGGGGCGGCCCAGG - Intronic
1176952760 21:15065330-15065352 GGGAGCCCGGGGGACGGCCCGGG - Intergenic
1178610405 21:34074050-34074072 GGACTCCCGCGGGCCGGCGCCGG - Intronic
1179502005 21:41815901-41815923 CGAGACCCTGGGGCAGGCACAGG + Intronic
1181055876 22:20260290-20260312 GGAGACCCTGGGGCTGGGCAGGG + Intronic
1182260998 22:29073095-29073117 GGGGCCCCGGGGCGCGGCCCGGG - Intronic
1183540720 22:38427858-38427880 GGTGACCTGGAGGCCAGCCCAGG - Exonic
1183590599 22:38777324-38777346 GGAGAGGCGGGGGCCGGCGCTGG - Intronic
1183605411 22:38864788-38864810 GGAGACCCGGGAAGTGGCCCAGG + Exonic
1183736759 22:39648818-39648840 GGAGACGCCTGGGCTGGCCCTGG - Intronic
1183927621 22:41217227-41217249 GGAGGCCGGGGAGCCGGGCCTGG + Intronic
1184004764 22:41699897-41699919 GGAGGCCCGCAGGCCGGCCTGGG - Intronic
1184034741 22:41913090-41913112 GGAGGCCAGGGTGCCAGCCCGGG + Intronic
1184037100 22:41923510-41923532 GGTGACCAGGGGGCTGGCACAGG + Intergenic
1184321768 22:43747391-43747413 GGAGAAGCTGGGGCCGGCTCTGG + Intronic
1184459402 22:44628507-44628529 GGAAACCAGTGGGCCTGCCCTGG - Intergenic
1184472156 22:44702177-44702199 GCGGACCCGGGGGCGGGCCCAGG - Intronic
1184730792 22:46369930-46369952 GGAGTCCAGGGAGCCAGCCCAGG + Intronic
1184734912 22:46392292-46392314 GGAGTCCCGGTGACCAGCCCAGG - Intronic
1184744108 22:46446154-46446176 GGAGACAGTGGGGCCGGCACAGG - Intronic
1185044795 22:48523505-48523527 GGAGCCCCGAAGGCTGGCCCGGG + Intronic
1185250516 22:49799348-49799370 GGTGAGCAGGGGGCTGGCCCCGG + Intronic
1185278826 22:49961291-49961313 GGAGACGCGGGGGTCAGGCCGGG - Intronic
950012313 3:9732090-9732112 GGAGCCCCGGCGGGCGCCCCCGG + Exonic
950097562 3:10338823-10338845 GGAGAACCGAGGGCCAGCCACGG - Intronic
950714173 3:14836139-14836161 GGAGACCCTGGGGCTGACCTGGG + Intronic
951881424 3:27484272-27484294 GGAGAGCCGGGCGCCGGGCGCGG + Intronic
952901581 3:38114979-38115001 GGAGACCTGGGTGCCGAACCTGG - Exonic
953921791 3:46956918-46956940 CGAGACCCGAGGTCTGGCCCTGG - Intronic
955326107 3:58010183-58010205 GGAGAACCAGGGACTGGCCCTGG + Intronic
955356224 3:58235522-58235544 GGAGACCAGGGAGCAGTCCCAGG - Intergenic
957072852 3:75579881-75579903 GGAGGCTCCGTGGCCGGCCCCGG - Intergenic
957662808 3:83183559-83183581 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
959316999 3:104821790-104821812 GGGGACCATGGGCCCGGCCCAGG - Intergenic
959512836 3:107233594-107233616 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
959893693 3:111583786-111583808 GGGGACCCTGGGCCCAGCCCAGG + Intronic
961281218 3:125766876-125766898 GGAGGCTCCGTGGCCGGCCCTGG + Intergenic
961688247 3:128650414-128650436 GGAGACCCGGGCGGCGGGCGGGG - Intronic
961831780 3:129626839-129626861 GGAGAGCCTGGGGCCTGGCCTGG - Intergenic
961873158 3:130002709-130002731 GGAGGCTCCGTGGCCGGCCCCGG - Intergenic
963091417 3:141486971-141486993 CGAGGCCCGGGGGCGGGGCCAGG + Intergenic
963168065 3:142225241-142225263 TGAGTCCCGGGGTCCGGCCTCGG - Intronic
963827281 3:149970182-149970204 AGAATCCCGGGGGCCGGGCCGGG + Intronic
965127508 3:164649523-164649545 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
966883660 3:184362940-184362962 GAGGACCCCGGGGCCGGCCTGGG - Intronic
966900562 3:184481073-184481095 GGTGACCAGGTGGCAGGCCCTGG + Intronic
967133465 3:186493891-186493913 GGGGACCGGGGGGACGGACCTGG - Intergenic
967218115 3:187227311-187227333 GGAGCCCTGGGGTCTGGCCCTGG - Intronic
968479472 4:826884-826906 AGAGACCCGCAGGCCGGCCCGGG + Intergenic
968701375 4:2059647-2059669 GGGGGCGCGGCGGCCGGCCCGGG - Exonic
968750599 4:2387050-2387072 GGAGACTCCGGGGCCGGGGCCGG + Intronic
968799616 4:2733492-2733514 GGAGTCCCGGGGGCCTGCACTGG - Intergenic
968957270 4:3725810-3725832 GGAGGGCCGGGGGCTGGCTCCGG - Intergenic
969259173 4:6022772-6022794 GGAGTCCATGTGGCCGGCCCGGG - Intergenic
969333980 4:6495956-6495978 GGAGAGCCGGGAGGGGGCCCTGG - Intronic
969667894 4:8572564-8572586 AGAGACCAGGGGGCTGGCCTGGG - Intronic
969737491 4:9001133-9001155 GGAGGCTCCGTGGCCGGCCCTGG + Intergenic
969796694 4:9532696-9532718 GGAGGCTCAGTGGCCGGCCCCGG + Intergenic
970581418 4:17477441-17477463 GAAGAGCCGTGGGCAGGCCCTGG + Intronic
971757437 4:30721339-30721361 GGAGGGCAGGCGGCCGGCCCCGG + Exonic
972437250 4:39045343-39045365 GGCGGCCCGGGCGCCGGCTCCGG - Intronic
973182909 4:47291104-47291126 GGGGACCCTGGGCCCGTCCCAGG - Intronic
974047347 4:56908612-56908634 GGAGGGCCGCGGGCCGGCGCGGG - Intronic
976172393 4:82317901-82317923 GAAGACCCTGGGCCCAGCCCAGG - Intergenic
978741906 4:112145940-112145962 CGCGACCCCGGGGCCGGCGCTGG - Intronic
980494937 4:133578158-133578180 GGGGACCCTGGGCCCAGCCCAGG - Intergenic
982257660 4:153466304-153466326 GGCGGCACGGGGGCGGGCCCGGG + Intergenic
985159923 4:187033987-187034009 GGAGACCCTGGGCCTGGCCCAGG - Intergenic
985766164 5:1780569-1780591 GGACACCCGGGAGCCACCCCTGG - Intergenic
985895458 5:2748253-2748275 GGAGACCCGAGGGAGGGTCCGGG - Intronic
985995943 5:3596722-3596744 GGAACCCCGTGGGCCTGCCCGGG - Intronic
987810368 5:22827081-22827103 GGAGACTCTGGGCCCAGCCCAGG - Intronic
987989369 5:25190743-25190765 GGAGACCCGGGTGCCGGCGGGGG + Intergenic
988437540 5:31193840-31193862 GGAGACCCTGCGACCCGCCCAGG - Exonic
992105750 5:73448080-73448102 GGCGCCCCCGGGCCCGGCCCCGG - Exonic
992656013 5:78910196-78910218 GGAAACCCGGGGACCGGTGCCGG + Intronic
993095315 5:83473112-83473134 GGAGCCCCGGGGGACGTCCTCGG + Intronic
993945324 5:94111464-94111486 TGAGCTCCGGGGGCAGGCCCGGG - Intronic
996033570 5:118733607-118733629 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
997470623 5:134115114-134115136 GGGGTCCCGGGGGCCGGCGCCGG + Exonic
997521288 5:134525902-134525924 GGAGCTCCTGGGGCCGGCGCGGG - Intronic
1001395890 5:171419575-171419597 GGGGGGCCGGGGGCGGGCCCGGG - Intergenic
1001773224 5:174311305-174311327 GGAGGCCCGGGGGCGGGGACAGG + Intergenic
1001826666 5:174751151-174751173 GGGAGCCCGGGGGCCGGCCGAGG - Intergenic
1002196301 5:177503488-177503510 GGAGACCCGGAGGCCCGAGCTGG - Intronic
1002350169 5:178577567-178577589 GGAGACCTGGGGAACAGCCCAGG + Intronic
1002487655 5:179550633-179550655 GCTGACCCGGGCCCCGGCCCCGG - Exonic
1002898810 6:1393915-1393937 GGGGACCGGGGAGCCGCCCCGGG + Intronic
1002904512 6:1438002-1438024 GGAGACCCGAAGGGCAGCCCCGG - Intergenic
1002925741 6:1604896-1604918 GGAGCCCCGGGGGCCTGGGCCGG - Intergenic
1003080266 6:3015936-3015958 GGCAACCCGGTGGCCAGCCCTGG + Intronic
1003661207 6:8064171-8064193 CGGGACCCGGGGGTCGGCCCGGG + Intronic
1004113993 6:12749364-12749386 GGAGCCCCGGGCGCCAGCCAGGG + Intronic
1004190260 6:13457427-13457449 GGAGACTCTGGGTCCTGCCCCGG - Intronic
1005959930 6:30687273-30687295 AGAGACCAGGGGGCCGGGCGGGG + Exonic
1006547555 6:34792304-34792326 GGACCGCCGGGGGCCGGCGCTGG - Intronic
1006614732 6:35318531-35318553 GGAGCGCCGGGGGCGGGGCCTGG + Intronic
1007072618 6:39048479-39048501 GGAGACCCGGGAGGAGGTCCGGG + Intergenic
1007765026 6:44155075-44155097 GGAGAGCCCCGAGCCGGCCCCGG + Exonic
1007889266 6:45271337-45271359 GGGGACCCTGGGCCTGGCCCAGG - Intronic
1011419399 6:87155702-87155724 GGAGAGCCGGGTACCGGCCGTGG + Exonic
1011640171 6:89411300-89411322 GGAGACCCGCGGGGCGGCGGGGG - Intronic
1012997265 6:105986099-105986121 GGAGACCCGGCGCCCTGCCCAGG - Intergenic
1013155735 6:107490051-107490073 GGCGGGCCGGGGGCCGGCGCGGG - Exonic
1015149312 6:130020116-130020138 GGTGGCCCCGGCGCCGGCCCCGG - Intronic
1016987859 6:149908680-149908702 GGGGACCCTGGGCCTGGCCCAGG - Intergenic
1018356755 6:163025795-163025817 GGAAGCCAGGGGGCAGGCCCAGG + Intronic
1018613204 6:165662651-165662673 GGCCACTCGGGGGCCGGGCCCGG + Intronic
1019519162 7:1452900-1452922 GGAGGCTGGAGGGCCGGCCCTGG - Intronic
1019745925 7:2700378-2700400 GGCCACCCGGGGGACGGCCACGG - Exonic
1019989667 7:4682605-4682627 GCAGAGCCCGGGGCCGGCGCTGG + Exonic
1020274324 7:6615587-6615609 GGGGGCGCGGGGGCCGGCACAGG - Intergenic
1020275833 7:6623877-6623899 TGCTACCCAGGGGCCGGCCCGGG + Exonic
1020461501 7:8434076-8434098 GGAGTCCCGGGCGCTGTCCCTGG - Exonic
1021231028 7:18086659-18086681 GGAGACCCGCAGGGCGGGCCGGG - Intergenic
1021809898 7:24392942-24392964 GGAGACACTGGGGCCTGCCCAGG + Intergenic
1022797709 7:33745358-33745380 GGACACCCGGGAGCCAGCCTAGG + Intergenic
1023025940 7:36049622-36049644 GGAGACCCGGGTTCCAGTCCAGG + Intergenic
1024247820 7:47483706-47483728 GGACACCCTGGGGCCAGGCCAGG - Intronic
1026850359 7:73719721-73719743 GGGGTCCCGGGGGCCGGGGCGGG - Intergenic
1026935799 7:74254560-74254582 GGAGACCTGGCGCCCGGCCTGGG + Intergenic
1029098378 7:98107137-98107159 GGCGACTCGAGGGCCGGCCCCGG + Exonic
1029110617 7:98211538-98211560 GGGGACCCAGGGGCAGGACCTGG + Intronic
1029709918 7:102293825-102293847 AGAGACACAGGGCCCGGCCCAGG + Intronic
1030786584 7:113670760-113670782 AGAGACCCTGGGCCCAGCCCAGG - Intergenic
1030967031 7:116005833-116005855 GGGGACCCTGGGACTGGCCCAGG - Intronic
1031919054 7:127588322-127588344 CGAGAGCCGGGGGCGGGGCCCGG + Intronic
1033477031 7:141701747-141701769 CGGGAGCCCGGGGCCGGCCCTGG + Intronic
1034432664 7:151048909-151048931 GGAGGCCCGGCGGCCAGCCTCGG + Exonic
1034564081 7:151899601-151899623 GGAGACCCGGGTTCCAGTCCGGG - Intergenic
1034902095 7:154914211-154914233 GGAGAGCCGGGGTCAGGCTCCGG + Intergenic
1034969592 7:155410801-155410823 GGAGGCCAGAGGGCCGGCCCAGG + Intergenic
1035125851 7:156607480-156607502 GGAGACCCCGGGGCTGGGACAGG - Intergenic
1035168043 7:157003215-157003237 GGAGGCGCAGGGGCCGGCGCAGG + Intronic
1035266597 7:157693019-157693041 GGCGACCCCAGGCCCGGCCCTGG + Intronic
1035310066 7:157961930-157961952 GGAGACCCGGCGGCCACACCTGG + Intronic
1035355166 7:158272267-158272289 GGAGACCACAGGGCCTGCCCGGG - Intronic
1035771303 8:2148923-2148945 GGAGACCCCTGGGCAGGTCCCGG - Intronic
1036258210 8:7221634-7221656 GGAGGCTCCGTGGCCGGCCCCGG - Intergenic
1036310258 8:7680230-7680252 GGAGGCTCCGTGGCCGGCCCCGG - Intergenic
1036717970 8:11144502-11144524 GGAGACCAGGGCGCAGGCACAGG + Intronic
1036830146 8:12014751-12014773 GGAGGCTCCGGGGCCGGCCCTGG - Intronic
1036891679 8:12601079-12601101 GGAGTCTCAGTGGCCGGCCCCGG - Intergenic
1037108367 8:15137519-15137541 GGAGGCCCTGGGCCCAGCCCAGG - Intronic
1037957148 8:23068790-23068812 GGGGACCCGGGGCCCAGGCCTGG + Exonic
1037979146 8:23238208-23238230 GGGGACCCTGGGCCTGGCCCAGG + Intergenic
1038546700 8:28431196-28431218 GGAGGCCCTGGGGCCTGCCATGG - Intronic
1038798239 8:30727866-30727888 GGCGGCCCGGGGGCGGTCCCCGG + Exonic
1039542484 8:38382911-38382933 GGAGACCCGGCCGGCGGCGCCGG + Intergenic
1039682300 8:39753608-39753630 GGGGACCCTGGGCCCTGCCCAGG - Intronic
1040072251 8:43197987-43198009 GGTGACCAGGAGGCAGGCCCAGG + Intronic
1040289370 8:46116522-46116544 GGAAACCTGGGAGCCTGCCCAGG - Intergenic
1040322745 8:46326867-46326889 AGAGACCCAGGGTCTGGCCCAGG - Intergenic
1040323571 8:46330137-46330159 GGAGACCCTGGGGGCACCCCGGG - Intergenic
1041068032 8:54101488-54101510 GGACCCCCGCGGGCCGGCCTAGG - Intronic
1048116679 8:131531741-131531763 GGGGACCCTGGGCCCAGCCCAGG - Intergenic
1048554023 8:135457754-135457776 GGGGACCCGGGGGCCAGACGCGG - Exonic
1049261569 8:141641804-141641826 GGAGCACCGGGGGCTGGCACTGG + Intergenic
1049407754 8:142459274-142459296 GGAGCCCCGGGGGTTGGACCTGG - Intronic
1049614288 8:143569346-143569368 GGAGAGACGGGGGCGGGGCCTGG + Intronic
1049710456 8:144060797-144060819 GGAGGCGCGGGGGGCGGGCCCGG - Intronic
1049832749 8:144712859-144712881 GGAGACCGCTGGGGCGGCCCTGG - Intergenic
1050304985 9:4298238-4298260 GGGGACCGGGGGGCCGGCGTGGG - Intronic
1052362230 9:27573492-27573514 GCGGGCCCGGGGGCGGGCCCGGG - Intronic
1056856559 9:90134804-90134826 GGAGCCCCGGTGGCCGGGCGCGG - Intergenic
1057305992 9:93912316-93912338 GGAGCCCAGGGAGCCTGCCCTGG - Intergenic
1058967277 9:110049370-110049392 GGAGGGCCGGGCCCCGGCCCCGG + Intronic
1060222662 9:121772871-121772893 GGTGGCCGGGTGGCCGGCCCGGG + Exonic
1060246914 9:121954117-121954139 GGAGACCCGGGTTCTAGCCCCGG - Intronic
1060519053 9:124283560-124283582 GGAGAGCTGGGTGCCAGCCCTGG + Intronic
1060749131 9:126157418-126157440 GGACACCAGGGGGCCAGCACTGG - Intergenic
1060918458 9:127404768-127404790 GGGCACCCGGGGAACGGCCCAGG - Intronic
1061060932 9:128250360-128250382 GGGGCCGTGGGGGCCGGCCCTGG - Intronic
1061368940 9:130187170-130187192 GGAGACGGGGGGCCCTGCCCAGG + Intronic
1061453604 9:130681933-130681955 GGAGACTCGGGGGCGAGGCCAGG - Exonic
1061559462 9:131393777-131393799 GGAGACCCGGAGGAGGGGCCAGG - Intergenic
1061559783 9:131394630-131394652 CGAGACCCGGCTGCGGGCCCGGG - Intronic
1062110933 9:134781794-134781816 GGAGCCCCGGGAGCTGGCGCTGG + Intronic
1062112957 9:134792099-134792121 GAGGAGCCGGGGGCCGGCACAGG + Intronic
1062408568 9:136410064-136410086 AGAGACGAGGGCGCCGGCCCCGG - Intronic
1062422492 9:136489868-136489890 GGGGACCTGGGTGCTGGCCCTGG - Intergenic
1062616555 9:137399245-137399267 GGAGACCCCGGGGCCGTGGCCGG + Intronic
1185505456 X:630095-630117 GGAGACCCGGGAGGCGGCCCCGG + Intronic
1186455549 X:9707524-9707546 GGAGACCCATGAGCCGGCTCTGG + Intronic
1186679347 X:11855236-11855258 GGAGGCCCTGGGCCTGGCCCAGG + Intergenic
1188443788 X:30235972-30235994 GCAGACCCGGGGTCAGACCCAGG + Exonic
1189028865 X:37429071-37429093 GGGGACCCTGGGCCTGGCCCAGG + Intronic
1189176594 X:38963658-38963680 GGGGACCCTGGGCCCAGCCCAGG + Intergenic
1189717621 X:43882171-43882193 GGAGACGCGGGGGGCGGCCGTGG - Intronic
1189915534 X:45851717-45851739 GGGGACCAGGGGTGCGGCCCTGG + Intergenic
1190024662 X:46912535-46912557 TGAGGCGCGGGGGGCGGCCCCGG + Exonic
1190324834 X:49200024-49200046 GGAGACCCGGTCCCCGGCGCTGG - Intronic
1192212566 X:69137163-69137185 GGGGACCCGGGGGACGGGGCGGG - Intergenic
1193498362 X:82240708-82240730 GGAGACTCTGGGCCCAGCCCAGG - Intergenic
1193707908 X:84845087-84845109 GGAGACCCTGGGCCCAGCCCAGG + Intergenic
1193711309 X:84883839-84883861 GGAGACCCTGGGCCCAGCCCAGG - Intergenic
1200077405 X:153558012-153558034 GGAGAGCAGGGAGCCAGCCCAGG + Intronic
1200111426 X:153742924-153742946 CCAGACCCGGGGGCCAGCCGGGG - Intronic
1200256265 X:154584848-154584870 GGAGACCCGGGGGATGGGACAGG + Intergenic
1200261504 X:154619555-154619577 GGAGACCCGGGGGATGGGACAGG - Intergenic
1200267487 X:154653852-154653874 GGAGACCCGGGGGATGGGACAGG - Intergenic
1200787713 Y:7274315-7274337 GGAGGCGCCCGGGCCGGCCCAGG + Intergenic