ID: 1081812878

View in Genome Browser
Species Human (GRCh38)
Location 11:45923092-45923114
Sequence AGACCCGGGGGCCGGCCCCG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 205}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812864_1081812878 16 Left 1081812864 11:45923053-45923075 CCCAGACGGGAGGCTGCGGAGAG 0: 1
1: 0
2: 1
3: 18
4: 288
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812861_1081812878 19 Left 1081812861 11:45923050-45923072 CCCCCCAGACGGGAGGCTGCGGA 0: 1
1: 0
2: 0
3: 13
4: 280
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812858_1081812878 27 Left 1081812858 11:45923042-45923064 CCACGTGTCCCCCCAGACGGGAG 0: 1
1: 0
2: 0
3: 7
4: 87
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812870_1081812878 -10 Left 1081812870 11:45923079-45923101 CCGCCCTCGACGGAGACCCGGGG 0: 1
1: 0
2: 0
3: 5
4: 73
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812867_1081812878 -7 Left 1081812867 11:45923076-45923098 CCGCCGCCCTCGACGGAGACCCG 0: 1
1: 0
2: 0
3: 3
4: 81
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812862_1081812878 18 Left 1081812862 11:45923051-45923073 CCCCCAGACGGGAGGCTGCGGAG 0: 1
1: 0
2: 0
3: 17
4: 136
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812863_1081812878 17 Left 1081812863 11:45923052-45923074 CCCCAGACGGGAGGCTGCGGAGA 0: 1
1: 0
2: 2
3: 14
4: 143
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205
1081812865_1081812878 15 Left 1081812865 11:45923054-45923076 CCAGACGGGAGGCTGCGGAGAGC 0: 1
1: 0
2: 0
3: 16
4: 161
Right 1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG 0: 1
1: 0
2: 1
3: 21
4: 205

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812878 Original CRISPR AGACCCGGGGGCCGGCCCCG GGG Exonic
900090161 1:916747-916769 AGCTCCCGGGGCCGGCGCCGAGG + Intergenic
900113542 1:1019593-1019615 AGCCTCGGTGTCCGGCCCCGCGG + Intergenic
900129870 1:1082833-1082855 GGACCCGGAGGCCGACCCCTTGG - Exonic
900388084 1:2419688-2419710 AGACCCGGGGGCCAGCTTTGAGG + Intergenic
900402922 1:2480006-2480028 AGACCCAGGGACCGGCCCCTTGG + Intronic
900786954 1:4655323-4655345 AGAGCCGGAGACCGGCGCCGCGG + Exonic
900950745 1:5857076-5857098 AAACCCAGGGGCCTGGCCCGAGG + Intergenic
902304114 1:15524286-15524308 TGACGCGGGGGCAGGCCCTGGGG - Exonic
902457765 1:16548178-16548200 AGCCCCGACGGCCGGCGCCGGGG - Intergenic
902475211 1:16680519-16680541 AGCCCCGACGGCCGGCGCCGGGG - Intergenic
902494395 1:16859735-16859757 AGCCCCGACGGCCGGCGCCGGGG + Intronic
903462301 1:23528432-23528454 ATGCCCGGGGCCCAGCCCCGTGG - Intronic
904500123 1:30908529-30908551 CGGCCCCGGCGCCGGCCCCGTGG + Exonic
904753205 1:32753982-32754004 AGACTCGCGGGCGGGCACCGCGG - Intronic
905028935 1:34868773-34868795 AGTCACGGCGGCCGGCCCCAGGG + Exonic
905580801 1:39081726-39081748 AGCCCCCGCGGCCGGCGCCGGGG + Intronic
905811533 1:40916918-40916940 GAACCCGGGGGCCTGCCCCCAGG + Intergenic
905811534 1:40916921-40916943 TGACCTGGGGGCAGGCCCCCGGG - Intergenic
905947803 1:41918235-41918257 AGACGCAGGGGCCGGCCGGGTGG - Intronic
915751152 1:158212529-158212551 AGTCCCTGGGGCCCGCCCCTAGG + Intergenic
918480784 1:184974540-184974562 TGATCCGTGGGCCGGCCCGGGGG + Exonic
922753422 1:228081730-228081752 AGGCCCGGGGGCAGGGCCTGAGG - Intergenic
924246464 1:242090616-242090638 AGACCCAGGATCCGGCCCCTTGG + Intronic
1064011850 10:11742290-11742312 CGAGCCGGGGGCGGGCCTCGTGG + Intergenic
1065110616 10:22436800-22436822 AGACCCGGAGGCCGTCCCAGGGG - Intronic
1067038016 10:42933475-42933497 AGAGCCGAGGGCAGGCCCTGGGG + Intergenic
1069677002 10:70255491-70255513 GCCCCCGGGGGCCGGGCCCGGGG + Exonic
1069677005 10:70255494-70255516 AGGCCCCGGGCCCGGCCCCCGGG - Exonic
1069913540 10:71773645-71773667 CTTCCCGGAGGCCGGCCCCGTGG + Intronic
1074182944 10:111078969-111078991 AGACCCGAGCGCGGTCCCCGGGG + Exonic
1075112025 10:119596015-119596037 GGGCCCGGGGGTGGGCCCCGCGG - Intronic
1075504977 10:123013631-123013653 AGGTCCCGGGGCCTGCCCCGCGG + Intronic
1076431930 10:130410144-130410166 AGACCTGGGGCCTGGCCCCTCGG + Intergenic
1076750055 10:132537973-132537995 TGCGCCGGGGGGCGGCCCCGGGG - Exonic
1076884344 10:133254773-133254795 AGACACGGGGTCCAGCCCGGTGG - Intergenic
1076894528 10:133303378-133303400 AGCTCCGGGAGCCAGCCCCGTGG + Intronic
1077391640 11:2303118-2303140 AGACCCGAGGCCCTGCCCAGGGG - Intronic
1081812878 11:45923092-45923114 AGACCCGGGGGCCGGCCCCGGGG + Exonic
1081812879 11:45923095-45923117 GGTCCCCGGGGCCGGCCCCCGGG - Exonic
1083667914 11:64285451-64285473 AGGCCCGGGGGCGGGGCCCGGGG + Intronic
1084109221 11:67002735-67002757 ACTCCCGGGGGCAGGGCCCGGGG - Intergenic
1084621058 11:70270627-70270649 CGCCCCGGGGGCGGGGCCCGAGG - Intergenic
1085123614 11:73982874-73982896 AGCCTCGGGGGCGGGGCCCGGGG + Exonic
1089634423 11:119803321-119803343 AGGCCCTGGGCCCAGCCCCGAGG + Intergenic
1090002953 11:122977779-122977801 AGCCCCGAGGGCAGCCCCCGCGG - Exonic
1092281649 12:7102014-7102036 TGACCAGGGGGCCTGCCCAGAGG + Exonic
1094624185 12:32107054-32107076 GCACGCAGGGGCCGGCCCCGAGG + Intronic
1095943473 12:47740676-47740698 GGGCCCGGGGGCCGGGCACGGGG + Exonic
1096774377 12:53955271-53955293 CGACCCGGGAGCCGGGCCCGGGG + Exonic
1097996055 12:65888846-65888868 AGCCACGGCGCCCGGCCCCGTGG + Intronic
1103505688 12:121441230-121441252 GCACCTGGGGACCGGCCCCGTGG + Exonic
1104854133 12:131894395-131894417 TGACCCGGGAGCGGGCCACGGGG - Intergenic
1104972445 12:132538108-132538130 TGACCCAGGGGCCGGTCCCTGGG + Intronic
1105000711 12:132688029-132688051 AGACCCGGGGGTCGGCGCTGAGG + Intronic
1110705942 13:78602182-78602204 CGGCCCGGGCGGCGGCCCCGGGG - Exonic
1113640967 13:111956412-111956434 AGGCCAGGGGGCGGGCACCGTGG + Intergenic
1113861596 13:113490772-113490794 AGTGCCGGGAGCCGGCCGCGGGG + Exonic
1114269513 14:21092277-21092299 AGGCCCGGAGGCAGGCCCCGGGG + Exonic
1115261305 14:31457165-31457187 AGACCGGCGGTCCGGCCGCGGGG - Intronic
1116817888 14:49599860-49599882 GGGCCGGGGGGGCGGCCCCGCGG + Intronic
1119500870 14:75126672-75126694 AGACAGGGCGGCCGGCGCCGAGG + Intronic
1121020488 14:90577408-90577430 AGACCCTGGAGCCGGCCACCTGG - Intronic
1121253001 14:92513621-92513643 CGCCCCGAGGCCCGGCCCCGGGG + Intergenic
1121671547 14:95714199-95714221 CGACCCGGGGTCCCGCCCCAAGG - Intergenic
1122113267 14:99515849-99515871 AGGCCCGGGGGCCAGCACCCAGG + Intronic
1122625617 14:103084120-103084142 AGGACCGGCGGCCAGCCCCGCGG + Intergenic
1122905817 14:104800977-104800999 AGTCCCGGGACCCGCCCCCGCGG + Exonic
1122947771 14:105021004-105021026 GGACCCGGCGGGCGGCCTCGCGG - Exonic
1124370761 15:29103606-29103628 AGCCCGGGGAGCCGGCTCCGCGG - Intronic
1127480250 15:59371795-59371817 TGTGCCGGGCGCCGGCCCCGAGG - Intronic
1128103934 15:65029332-65029354 CGCCCGGGCGGCCGGCCCCGAGG - Intronic
1128115524 15:65102498-65102520 AGACCCGGAGGCCGGACACCAGG - Exonic
1128153541 15:65377853-65377875 CGGCCCCGGCGCCGGCCCCGCGG - Exonic
1128322259 15:66702105-66702127 CGCCCCGGGAGCCGGCCCCTTGG + Intergenic
1128982504 15:72197697-72197719 CGGCCCGGGGGCCGGTCTCGGGG - Intronic
1129877448 15:78984925-78984947 AGACCCGTGGGCTGGCCACTGGG - Intronic
1131257485 15:90871821-90871843 TGGCCCCGGGGCCGGCCCCGAGG + Intronic
1132779349 16:1614307-1614329 AGACCCCGGGGCCGGGGCCGGGG + Intronic
1132926072 16:2429655-2429677 AGCCCCGGCGGCCGGGCGCGCGG + Intronic
1133004153 16:2868482-2868504 AGACCCAGCGGCCGAGCCCGGGG + Intergenic
1138591061 16:58000171-58000193 CGACCCGAGGGCGAGCCCCGAGG + Intronic
1139364997 16:66427525-66427547 ACACCCGGGGGCGCGCCGCGCGG + Intronic
1141669618 16:85485003-85485025 AGGCCCGGGGCCAGGCCCTGGGG + Intergenic
1141833604 16:86523569-86523591 TGTGCCGGGGGCCGGCCCCCGGG + Intergenic
1142142722 16:88479730-88479752 AGACCAGGAGGCCAGCCCTGGGG + Intronic
1142237949 16:88931521-88931543 AGGGCCGTGGGCCGGCCCCGTGG + Intronic
1142237963 16:88931562-88931584 AGGGCCGTGGGCCGGCCCCGTGG + Intronic
1142237977 16:88931603-88931625 AGGGCCGTGGGCCGGCCCCGTGG + Intronic
1142762336 17:2049995-2050017 AGACGCGGGGGCGGGGCGCGCGG + Intergenic
1142799652 17:2337375-2337397 AGACCCGGGCGCGCGCCACGGGG - Exonic
1143223678 17:5282465-5282487 TGACCAGGCGGCCGGCCTCGGGG - Exonic
1145254854 17:21316877-21316899 AGCCCCGAGGGCCGGGCCAGGGG - Intergenic
1145321746 17:21771088-21771110 AGCCCCGAGGGCCGGGCCAGGGG + Intergenic
1146281971 17:31550365-31550387 AGACGCGGGGACCGGCGGCGAGG - Intergenic
1148225104 17:45894077-45894099 GGACTCGAGGGCCGGCCACGTGG + Intergenic
1148556456 17:48581641-48581663 AGGCCCGGCCGCCGGCCCAGCGG - Intronic
1150139694 17:62717486-62717508 TGGCCCAGGGGCCGGCCCCATGG + Intronic
1150285236 17:63950433-63950455 AGGCCCCGGCCCCGGCCCCGGGG + Intronic
1150653724 17:67025890-67025912 AGAACCGGGGCCCGGCACCTTGG - Intronic
1151783839 17:76265641-76265663 ACCCCCGCGGCCCGGCCCCGCGG - Intronic
1152797527 17:82315537-82315559 AGACCTGGGGGCCAGCCCAGAGG - Intronic
1154270022 18:12911191-12911213 AGTCCCGGGGGCGAGCCACGCGG - Intronic
1155257780 18:24014167-24014189 CGACCCTGGGGCCGCCCCCTAGG - Intronic
1156473908 18:37394086-37394108 AGACCCGCGGGAGGGGCCCGCGG + Intronic
1158649675 18:59273864-59273886 AGGCCAGGGTGGCGGCCCCGCGG - Intronic
1158938353 18:62384950-62384972 GGACCCGTGCGGCGGCCCCGAGG + Exonic
1158976707 18:62716475-62716497 CCAGCCGGGGGCCGGCCTCGGGG - Exonic
1160747899 19:720292-720314 AGACCCGGGCGCCGCCGCCCCGG - Intronic
1160766717 19:812046-812068 AGACCCGAGGGGCGGCGGCGCGG + Exonic
1161222085 19:3122473-3122495 AGCCCCGGGGGCCGCCTCCCGGG + Exonic
1162914211 19:13865556-13865578 AGGCCGGGGCGCCCGCCCCGGGG - Intronic
1163651692 19:18521662-18521684 AGACTCGCGCGCCGGGCCCGGGG - Intronic
1164401978 19:27909251-27909273 ACACCTGTGGGCCGGCTCCGTGG + Intergenic
1165420125 19:35718264-35718286 GGACCCGCGGGCCGGCCCACAGG - Exonic
1167261567 19:48461851-48461873 TCACCCGTGGGCCGGCGCCGCGG + Exonic
1167456291 19:49597930-49597952 AAACCCCGGGGCCGGGGCCGAGG + Exonic
1168378658 19:55901820-55901842 AAACCCGGGGGCTGGTCTCGAGG + Intronic
925725382 2:6865988-6866010 AGCCCCGGGAGCCGGCGCCTGGG - Intronic
927623012 2:24681997-24682019 AGACACTGCGCCCGGCCCCGTGG + Intronic
931517712 2:63059574-63059596 CGACCCCTGGGCCGGCCCCTCGG + Intergenic
931870060 2:66446774-66446796 AGCCCCGGCGGCCGTCCCCCGGG - Intronic
932625985 2:73296142-73296164 AGACCTGGGGGCAGGGCTCGGGG + Intergenic
932756761 2:74414889-74414911 AGACACGGGTGCCGGGGCCGAGG + Exonic
937315909 2:120931994-120932016 AGAGCCCAGGGCCAGCCCCGAGG - Intronic
941476126 2:165953711-165953733 AGCCCCGCGGCCCGGCCTCGGGG - Exonic
948140590 2:235669894-235669916 AGTGCCGGGGTCCGGGCCCGGGG - Intronic
948625366 2:239265079-239265101 AGAGCCAGGGGCCAGCCCTGGGG + Intronic
1169430097 20:5528796-5528818 AGACCCGGGGGGCTGTCCTGTGG - Intergenic
1170156621 20:13274675-13274697 AGGCCCGGGGGCCGGGCGCGGGG - Intronic
1171123086 20:22582333-22582355 AGTCTCGGAGGCCGGCCCGGCGG + Exonic
1173454006 20:43189509-43189531 AGACCCGGGTTCCGGCCATGGGG + Intronic
1175911480 20:62407229-62407251 GGGGCCGGGGGCCGGGCCCGGGG + Exonic
1176059682 20:63167074-63167096 AGACCGGGAGGCTGTCCCCGTGG - Intergenic
1176150878 20:63590149-63590171 AGGCCCGGGGGCAGCCCCTGCGG + Exonic
1176311654 21:5154023-5154045 AGACCCCCAGGCCGGCTCCGCGG + Intronic
1179446087 21:41431757-41431779 AGCCCCGGGGCCCGGCCTGGAGG + Intronic
1179582364 21:42351906-42351928 AGACCCTGAGGACAGCCCCGTGG - Intergenic
1180921649 22:19524461-19524483 GGGCCGGGGGGCCGGGCCCGGGG - Exonic
1181052701 22:20245345-20245367 AGACCAGCGGGCAGGCCCCAAGG - Intronic
1181266003 22:21631256-21631278 AGGCCTGGGTGCTGGCCCCGAGG - Intergenic
1181796961 22:25318288-25318310 GGCCCCGGGTGCTGGCCCCGGGG + Intergenic
1182355561 22:29720914-29720936 AGAGCCGCGGGCGGGCGCCGCGG - Intronic
1183650914 22:39152772-39152794 ACCCGCGGGGGCGGGCCCCGGGG - Intergenic
1183665514 22:39243966-39243988 CGACTCCGGGCCCGGCCCCGCGG + Exonic
1184472154 22:44702175-44702197 GGACCCGGGGGCGGGCCCAGGGG - Intronic
1185258521 22:49849340-49849362 GGAGACGGGGACCGGCCCCGCGG + Intergenic
951954769 3:28241838-28241860 AGACCCGGGGCGAGGCCCCTCGG - Intronic
952904122 3:38128529-38128551 AGACCCTGGGGATGGCCCAGAGG + Intronic
953385257 3:42502580-42502602 AGGGCTGGGGGCGGGCCCCGGGG - Intronic
953674055 3:44986255-44986277 AGATCCGGAGCCCTGCCCCGTGG + Intronic
954214569 3:49117184-49117206 AGGCGCAGGGGCTGGCCCCGGGG - Exonic
961817510 3:129558855-129558877 AGAACCAGGTGCCGGCCCCCGGG + Intronic
966886614 3:184380617-184380639 GGACCCGCGGGCAGCCCCCGGGG + Intronic
968433909 4:575508-575530 CGAGCCGGGGGCCGAGCCCGGGG + Intergenic
968568589 4:1327800-1327822 AGACCCAGGGGACGACCCAGGGG - Intronic
968750601 4:2387052-2387074 AGACTCCGGGGCCGGGGCCGGGG + Intronic
968799614 4:2733490-2733512 AGTCCCGGGGGCCTGCACTGGGG - Intergenic
968957268 4:3725808-3725830 AGGGCCGGGGGCTGGCTCCGGGG - Intergenic
969493017 4:7510623-7510645 AGAACAAGGCGCCGGCCCCGGGG - Intronic
969493031 4:7510672-7510694 AGAACAAGGTGCCGGCCCCGGGG - Intronic
970581420 4:17477443-17477465 AGAGCCGTGGGCAGGCCCTGGGG + Intronic
975689365 4:76949434-76949456 GGAGCCGGTGGCAGGCCCCGGGG + Intergenic
978741905 4:112145935-112145957 AGACGCCAGCGCCGGCCCCGGGG + Intronic
985472380 5:53935-53957 GGGCCCGGGGGCCGGGGCCGAGG + Intergenic
989643205 5:43603208-43603230 AGACCCGGGCTTGGGCCCCGCGG - Intronic
994670249 5:102755113-102755135 TGGCCCGGGAGCCGCCCCCGGGG + Intronic
995574459 5:113514218-113514240 AGACCCGGGTGCCGCCGCTGAGG - Intronic
997302246 5:132814218-132814240 AGACGCGGAGCCCGGGCCCGGGG + Exonic
997470625 5:134115116-134115138 GGTCCCGGGGGCCGGCGCCGGGG + Exonic
998166602 5:139847944-139847966 ACAGCCGCGGGCCGCCCCCGCGG - Exonic
999727139 5:154446369-154446391 AGCCGCGGGAGCCGACCCCGGGG + Exonic
1002925739 6:1604894-1604916 AGCCCCGGGGGCCTGGGCCGGGG - Intergenic
1004183089 6:13397545-13397567 AAACCCAGGGGCCGGCCCACTGG + Intronic
1005328138 6:24721500-24721522 AGTCCTGGGGGTCGGCCCCGCGG + Intergenic
1005847528 6:29792927-29792949 AGACCCTGGCCCCGCCCCCGCGG - Intergenic
1005864427 6:29927160-29927182 AGACCCTGGCCCCGCCCCCGCGG - Intergenic
1006043110 6:31271344-31271366 AGACCCTGGCCCCGCCCCCGCGG + Exonic
1006052701 6:31356438-31356460 AGACCCTGGCCCCGGCCCCGCGG + Exonic
1007765028 6:44155077-44155099 AGAGCCCCGAGCCGGCCCCGGGG + Exonic
1009402675 6:63275108-63275130 AGATCCGGAGCCCTGCCCCGAGG + Intergenic
1011633842 6:89352620-89352642 AGACCCGGGCAGCGGCCGCGTGG - Exonic
1018728715 6:166632927-166632949 AGCCCCTGCGCCCGGCCCCGAGG - Intronic
1019279386 7:192513-192535 TGACGCGGGGGGCGGCTCCGCGG + Intergenic
1021868295 7:24979920-24979942 AACCCCGGAGCCCGGCCCCGGGG - Exonic
1021958793 7:25852566-25852588 GGACGCGGGGGCCGGGCCCATGG - Intergenic
1023864360 7:44231868-44231890 AGACCAGGGGGCGGTCCCCCAGG - Intronic
1027609155 7:80337835-80337857 ACACCCCGGGGCCTGCCACGAGG - Intergenic
1031051923 7:116953695-116953717 AGGCCTGGGAGCCGGGCCCGCGG + Intronic
1032345203 7:131110177-131110199 AGCCCGGGGGGCCCTCCCCGCGG + Intronic
1036930677 8:12952326-12952348 AGACCCGGGCGCGGGCTCCGGGG - Intronic
1038798241 8:30727868-30727890 CGGCCCGGGGGCGGTCCCCGGGG + Exonic
1043857149 8:85276154-85276176 GGAGCGGCGGGCCGGCCCCGCGG + Intronic
1044692732 8:94895693-94895715 GGACCCGAGGGCCCGCCCCTCGG + Intronic
1045432058 8:102123822-102123844 CGCCCCGGGGGCCGGGGCCGGGG - Intronic
1045583056 8:103500210-103500232 ACACCCGGGAGCGGGCCGCGGGG - Intergenic
1049266493 8:141670568-141670590 ACCCCCGGTGGCCAGCCCCGAGG + Intergenic
1049548906 8:143247260-143247282 CCTCCCGGGCGCCGGCCCCGAGG + Exonic
1053149135 9:35732013-35732035 CGCCCCGGGGCCAGGCCCCGCGG + Intronic
1053319202 9:37080206-37080228 AGACCCGCAGCCCGGCCGCGTGG - Intergenic
1053323521 9:37120798-37120820 AGACCCGCAGCCCGGCCGCGTGG - Exonic
1055612023 9:78032406-78032428 AGTCGCGGGAGGCGGCCCCGCGG + Intergenic
1060389916 9:123268642-123268664 AGGCCAGGGGGCGGGCCCCGCGG + Intergenic
1061453442 9:130681264-130681286 GGACTCGGCGGCTGGCCCCGCGG + Exonic
1061916572 9:133758456-133758478 AGACCCTGGAGACTGCCCCGGGG + Intergenic
1062108006 9:134766200-134766222 AGAACCTGAGGCCTGCCCCGTGG + Intronic
1062346737 9:136118521-136118543 AGCACCGCCGGCCGGCCCCGAGG - Exonic
1062408566 9:136410062-136410084 AGACGAGGGCGCCGGCCCCGGGG - Intronic
1062473698 9:136717571-136717593 AGGCCTGGGAGCCGGCCCTGTGG - Exonic
1062618979 9:137411130-137411152 AGGCCCCGAGGCCGGCCCCCCGG + Intronic
1203760931 EBV:12786-12808 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203761860 EBV:15858-15880 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203762789 EBV:18930-18952 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203763718 EBV:22002-22024 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203764647 EBV:25074-25096 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203765576 EBV:28146-28168 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203766505 EBV:31218-31240 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1203767434 EBV:34290-34312 AACCCCGGCGGCTGGCCCCGAGG - Intergenic
1185469536 X:374167-374189 AGAGCCTGGGGACGGCCTCGGGG + Intronic
1185505458 X:630097-630119 AGACCCGGGAGGCGGCCCCGGGG + Intronic
1186477738 X:9871418-9871440 AGACCAAGGGGCCGGCCAGGAGG - Intronic
1187181468 X:16947004-16947026 AGACCCGGGGCCCCCGCCCGCGG - Exonic
1189333548 X:40156739-40156761 AGAACCGGCGGGGGGCCCCGGGG - Intronic
1189717619 X:43882169-43882191 AGACGCGGGGGGCGGCCGTGGGG - Intronic
1189821636 X:44874045-44874067 AGACCCGGCCGCGGGGCCCGGGG - Intronic
1190322323 X:49186426-49186448 ATGCCCGGGGGCGGGCCCTGCGG - Intronic
1199708495 X:150451398-150451420 AGACCCAGGGGCCAGCCCTGTGG + Intronic
1200163251 X:154019789-154019811 TGGCCGGGGGGCCGGGCCCGGGG - Exonic
1200239539 X:154486507-154486529 GGACCCGGCGGCCCGGCCCGGGG + Intronic