ID: 1081812918

View in Genome Browser
Species Human (GRCh38)
Location 11:45923219-45923241
Sequence CCGCAGATGTCCAAGAGGCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 106}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081812918_1081812923 -7 Left 1081812918 11:45923219-45923241 CCCGGCCTCTTGGACATCTGCGG 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1081812923 11:45923235-45923257 TCTGCGGGAATCACAGTACCTGG 0: 1
1: 0
2: 1
3: 11
4: 105
1081812918_1081812927 22 Left 1081812918 11:45923219-45923241 CCCGGCCTCTTGGACATCTGCGG 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1081812927 11:45923264-45923286 TCCAGCACTGGCCAGCCGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 232
1081812918_1081812929 23 Left 1081812918 11:45923219-45923241 CCCGGCCTCTTGGACATCTGCGG 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1081812929 11:45923265-45923287 CCAGCACTGGCCAGCCGGCTGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1081812918_1081812930 24 Left 1081812918 11:45923219-45923241 CCCGGCCTCTTGGACATCTGCGG 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1081812930 11:45923266-45923288 CAGCACTGGCCAGCCGGCTGGGG 0: 1
1: 0
2: 1
3: 25
4: 241
1081812918_1081812926 18 Left 1081812918 11:45923219-45923241 CCCGGCCTCTTGGACATCTGCGG 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1081812926 11:45923260-45923282 TCTGTCCAGCACTGGCCAGCCGG 0: 1
1: 0
2: 0
3: 21
4: 215
1081812918_1081812924 10 Left 1081812918 11:45923219-45923241 CCCGGCCTCTTGGACATCTGCGG 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1081812924 11:45923252-45923274 ACCTGGCGTCTGTCCAGCACTGG 0: 1
1: 0
2: 0
3: 9
4: 134

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081812918 Original CRISPR CCGCAGATGTCCAAGAGGCC GGG (reversed) Intronic
901404642 1:9038130-9038152 CCCCACATGCCCAAGAGTCCTGG - Intronic
901738241 1:11325840-11325862 CAGCCTATGTCCAAGAGGCAGGG - Intergenic
902434962 1:16392565-16392587 CCGCCGCTGTCCAAAAGACCAGG + Intronic
904775642 1:32904533-32904555 CCTCAGAGGTCCCAGAGGGCAGG - Intergenic
905257445 1:36694146-36694168 CCACAGAGGTCACAGAGGCCAGG + Intergenic
909474114 1:76062904-76062926 CAAAACATGTCCAAGAGGCCGGG + Intergenic
917534222 1:175863004-175863026 CAGCAGATCTTCCAGAGGCCTGG + Intergenic
918072483 1:181143092-181143114 CAGCAGATGTCACAGAGGCCTGG - Intergenic
1064456120 10:15488865-15488887 CAGCAGATTTCCAAGAGGCAGGG - Intergenic
1069034118 10:63630208-63630230 ACCCAGATGTCCAAGAGGCCGGG + Intergenic
1071723917 10:88176926-88176948 CAGCAGATTTCTTAGAGGCCAGG - Intergenic
1077444389 11:2583571-2583593 CCCCAGCTGTCCAAGGAGCCAGG - Intronic
1081109805 11:39121069-39121091 CCGCAGATGCCCAGAAGGGCTGG - Intergenic
1081812918 11:45923219-45923241 CCGCAGATGTCCAAGAGGCCGGG - Intronic
1088688533 11:112305215-112305237 CCAAAGCTGTCCAAGAGACCAGG - Intergenic
1091399014 12:171641-171663 CCCCAGGTGTCCAAGAGGGCAGG - Intronic
1100197460 12:92263247-92263269 CAGATGAAGTCCAAGAGGCCAGG + Intergenic
1103703335 12:122859057-122859079 CTGCAGGTGTCTATGAGGCCTGG - Exonic
1104302366 12:127575969-127575991 CTGCAGCTGTCCAGGAGGCATGG - Intergenic
1104383975 12:128332860-128332882 AGGCAGATGTCCAAGACCCCAGG - Intronic
1118709054 14:68504910-68504932 CTGCAGACCTGCAAGAGGCCAGG + Intronic
1118975235 14:70670973-70670995 CTGCAGACATCCAACAGGCCAGG - Intronic
1119582969 14:75804095-75804117 CAGCACATTTCCAGGAGGCCTGG - Intronic
1122118668 14:99540482-99540504 CCGCTCATCTCCAAGAGGCTGGG - Intronic
1122691887 14:103535447-103535469 CCACTCATGTCCAAGAGGCGGGG + Exonic
1122706588 14:103625757-103625779 CCTCCGATGTCCCAGGGGCCTGG + Intronic
1123106500 14:105844270-105844292 CCTGAGATGTCCATGTGGCCGGG - Intergenic
1123405703 15:20018415-20018437 CAGCAGAAGCCCAGGAGGCCCGG - Intergenic
1123515033 15:21025063-21025085 CAGCAGAAGCCCAGGAGGCCCGG - Intergenic
1128511719 15:68317523-68317545 CCCCAGAGGCCCCAGAGGCCAGG + Intronic
1128885121 15:71279613-71279635 CTGCAGAGGCCCAAGAAGCCAGG - Intronic
1129743945 15:78005052-78005074 CTGCAGACGTCCAAGAGGGAGGG + Intronic
1129921446 15:79322533-79322555 CCTAAGCTGCCCAAGAGGCCTGG - Exonic
1132115949 15:99136779-99136801 CTGCTGATGTCCGACAGGCCTGG + Exonic
1132400100 15:101499827-101499849 CCGCAGGTGTCCAAGAAGCAAGG + Intronic
1132772427 16:1571467-1571489 CCACAGATGTCCAAGAAGCAGGG + Exonic
1132798979 16:1742194-1742216 GCCCAGAGGTCCCAGAGGCCAGG - Intronic
1138593618 16:58017235-58017257 AGGCAGAAGGCCAAGAGGCCTGG - Intronic
1141659809 16:85435779-85435801 CCTCATCTGTGCAAGAGGCCTGG + Intergenic
1141946601 16:87315068-87315090 CAGCAGATGGCCCAGGGGCCAGG + Exonic
1146199412 17:30843234-30843256 CCTCAGCTGCCCAAGAAGCCAGG - Intronic
1147604645 17:41767605-41767627 ACGCTGAGGTCCCAGAGGCCTGG + Intronic
1147955826 17:44133950-44133972 CAGCAGATGACCAGGAGGCCTGG + Intergenic
1147994651 17:44354126-44354148 GCGTAGATGTCCACGAGGCGCGG - Exonic
1149606191 17:57926881-57926903 CCGCTTTGGTCCAAGAGGCCCGG - Intronic
1151855824 17:76721162-76721184 CCTCAGATGCCCAAGAGTCCAGG + Intronic
1152294020 17:79456317-79456339 CCCCAGATGTCCATGGTGCCTGG - Intronic
1154344483 18:13530849-13530871 CCGCAGATGTCCCAGGGTCATGG + Intronic
1160814055 19:1027227-1027249 CCCAAGGTGTCCCAGAGGCCAGG - Intronic
1161605491 19:5212546-5212568 CTGAAGATGCCCAAGTGGCCGGG + Intronic
1162584004 19:11547927-11547949 GCGCAGAGGTCATAGAGGCCAGG + Intronic
1162617317 19:11812862-11812884 ATGAAGATGCCCAAGAGGCCAGG + Intergenic
1163871421 19:19824483-19824505 AAGCAGCTGTCCAAGTGGCCCGG + Intergenic
1164104605 19:22097374-22097396 CAGCAGATGTGCAACAGACCTGG - Intergenic
1164566449 19:29329289-29329311 CTGGGGACGTCCAAGAGGCCTGG + Intergenic
1165232840 19:34398024-34398046 CCACAGATGTACAACATGCCTGG + Intronic
1166638271 19:44471229-44471251 CCTCAGATTTCCAAGTGGCTGGG + Intergenic
1167637291 19:50662341-50662363 CCACGGATGTCAAAGAGGCCTGG + Exonic
933606876 2:84392458-84392480 CATAAGATGTCCAAGAGGACGGG - Intergenic
934196984 2:89845666-89845688 CCGCAGTGGCCCAAGAGGCTGGG + Intergenic
935938274 2:108209906-108209928 CCACAGATAACCAAAAGGCCAGG - Intergenic
936066891 2:109339414-109339436 CCGCAGAAGACCAAGAGGACAGG - Intronic
936152143 2:110027762-110027784 CCGCACAAGGCCCAGAGGCCCGG + Intergenic
936192535 2:110343651-110343673 CCGCACAAGGCCCAGAGGCCCGG - Intergenic
937979647 2:127607436-127607458 CCCCACCTGCCCAAGAGGCCAGG - Intronic
941576808 2:167242999-167243021 CAGCAGATGTGCAACAAGCCCGG + Exonic
946397192 2:219449002-219449024 CCGCCGATCCCCCAGAGGCCAGG + Exonic
947102529 2:226636703-226636725 CAGCAGATGTACAAGAACCCAGG + Intergenic
948126724 2:235569517-235569539 GCTCAGAGGTACAAGAGGCCAGG - Intronic
1170188363 20:13618018-13618040 CTGCAGCTGCACAAGAGGCCTGG + Intronic
1172203567 20:33145786-33145808 CCACAAATGTCTAAGAGCCCAGG + Intergenic
1174058404 20:47815380-47815402 CCACAGATGTCCCTGAGTCCAGG - Intergenic
1175690911 20:61065483-61065505 AGGCAGATGTCCAAGAGACGGGG + Intergenic
1175780202 20:61677212-61677234 TCGCAGATATCACAGAGGCCAGG - Intronic
1176022865 20:62970996-62971018 CCGCAAATGACCACGGGGCCTGG - Intergenic
1176409384 21:6439738-6439760 CCGCAGAAGCCGGAGAGGCCTGG + Intergenic
1177191637 21:17858222-17858244 CAGCAGAAGTACAAGAGGCCAGG - Intergenic
1177693304 21:24538559-24538581 CTTCAGATGTTCAACAGGCCTGG - Intergenic
1179684877 21:43048060-43048082 CCGCAGAAGCCGGAGAGGCCTGG + Intergenic
1183514703 22:38258082-38258104 CAGCAGGTGGCAAAGAGGCCAGG + Intronic
1183689041 22:39377762-39377784 CCAGAAATGTCCAAGATGCCAGG + Intronic
1185116555 22:48941380-48941402 CCTCAGATGTGGGAGAGGCCTGG + Intergenic
949903038 3:8835737-8835759 TCCCATATGGCCAAGAGGCCAGG + Intronic
949977693 3:9475962-9475984 CCGCAGATACCCTGGAGGCCTGG - Exonic
953901398 3:46846006-46846028 CCGCAGATCTCCTGGAGGCGGGG - Intergenic
954409876 3:50365817-50365839 CAGCAGAGGTCCACCAGGCCAGG + Exonic
960949427 3:122989478-122989500 CAGCACATGTCCATGAGACCAGG - Intronic
961318902 3:126058903-126058925 CCTCAGCTGGCCATGAGGCCTGG - Intronic
962327218 3:134446180-134446202 TAGCAGAAGTCCAAGATGCCAGG + Intergenic
985952216 5:3231023-3231045 CTGCAGATGTTCCAGAGGCCTGG + Intergenic
987035316 5:14013294-14013316 CCCCAGATCTCCATGAGGCGGGG + Intergenic
990509735 5:56479791-56479813 CTGCAGATGCCCACGATGCCAGG + Intronic
992412814 5:76523519-76523541 CTGCAGATGTCAAATAGGCAAGG + Intronic
995050647 5:107698952-107698974 CCACAGGTGTCCAATAGGCTGGG + Intergenic
1002054325 5:176590046-176590068 AGGCAGATGTCACAGAGGCCTGG - Intronic
1003489678 6:6610443-6610465 TCTCAGATGCCCCAGAGGCCAGG - Intronic
1004206016 6:13592375-13592397 CCCCAGCTGTCCAATGGGCCAGG - Intronic
1006797757 6:36742158-36742180 ACACAGATGTCCCAAAGGCCGGG + Exonic
1007430759 6:41775419-41775441 CCGCCGATGTCAGACAGGCCAGG - Exonic
1015875254 6:137816144-137816166 CTGCAGATGTCCAAGTGACACGG + Intergenic
1015994786 6:138987374-138987396 CCGCAGGTGCCCGGGAGGCCTGG - Intronic
1017384164 6:153863086-153863108 CAGCAGATGTCTTACAGGCCAGG + Intergenic
1018635238 6:165854700-165854722 CCGCAGAAGCCCCAGAGGCCTGG + Intronic
1021411385 7:20332080-20332102 GCACAGATGGCCTAGAGGCCAGG + Intronic
1022969712 7:35505746-35505768 CAGCAGAAGTGCAAGTGGCCCGG - Intergenic
1023816623 7:43955508-43955530 ATGCAAATGTCCAACAGGCCTGG + Exonic
1036410378 8:8494375-8494397 GCGAAGATGTGGAAGAGGCCAGG - Intergenic
1039364348 8:36914651-36914673 ATGGAGATGTCCAGGAGGCCTGG - Intronic
1039710505 8:40051547-40051569 CCGCTGATATCCAAGAGGGGTGG + Intergenic
1039736144 8:40335098-40335120 CCTCAGATTCCCAAGAGGCTGGG - Intergenic
1040468558 8:47717280-47717302 CCTCAGCTCTCCCAGAGGCCAGG + Intronic
1046517328 8:115280395-115280417 CACCAGATGTACAAGAGGCATGG + Intergenic
1050431247 9:5564169-5564191 TTGGAGTTGTCCAAGAGGCCAGG + Intronic
1056042483 9:82682662-82682684 CCCCAGGTGTCTAAGAGGCTGGG + Intergenic
1056943660 9:90976019-90976041 CGGCAGATGTCCCAGATACCAGG - Intergenic
1059143574 9:111876903-111876925 CCGCAGCTTTCCAAGTAGCCAGG + Intergenic
1061486378 9:130922556-130922578 CAGCAGATGTCAGAGAGGCGGGG - Intronic
1061781901 9:133001064-133001086 CCGCTGAGCTCCAAGAGGGCGGG - Intergenic
1062142583 9:134967767-134967789 CCGCAGATGCCCGAGGAGCCTGG - Intergenic
1185788464 X:2910159-2910181 CCACCGATATTCAAGAGGCCAGG - Intronic