ID: 1081814327

View in Genome Browser
Species Human (GRCh38)
Location 11:45930022-45930044
Sequence TAGGGTAATGAGATGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 268}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081814327_1081814331 -5 Left 1081814327 11:45930022-45930044 CCACCATCCATCTCATTACCCTA 0: 1
1: 0
2: 0
3: 21
4: 268
Right 1081814331 11:45930040-45930062 CCCTAAGAGCCTTTTGCCCCTGG 0: 1
1: 0
2: 1
3: 10
4: 156
1081814327_1081814333 -4 Left 1081814327 11:45930022-45930044 CCACCATCCATCTCATTACCCTA 0: 1
1: 0
2: 0
3: 21
4: 268
Right 1081814333 11:45930041-45930063 CCTAAGAGCCTTTTGCCCCTGGG 0: 1
1: 0
2: 0
3: 9
4: 136

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081814327 Original CRISPR TAGGGTAATGAGATGGATGG TGG (reversed) Intronic
902944899 1:19828156-19828178 AAGAGTATGGAGATGGATGGTGG - Intergenic
902959638 1:19953905-19953927 CAGGGGAATCAGATGGAGGGAGG + Intergenic
906633312 1:47390577-47390599 TGAGGTAATAAAATGGATGGTGG - Intergenic
908008228 1:59748822-59748844 TATGGTAATGAGATGACTGATGG + Intronic
908642333 1:66239041-66239063 TAGGGAAATGAGATTGATCTGGG - Intronic
911749709 1:101482159-101482181 TAGGCTAATGAGATGACTAGTGG - Intergenic
912445438 1:109732481-109732503 TAGGGAGTTCAGATGGATGGTGG - Intronic
914934760 1:151968702-151968724 TATGCTAATGAGATGACTGGTGG + Intergenic
916765983 1:167861325-167861347 GAGGGTCATGACCTGGATGGGGG - Intronic
917635717 1:176933854-176933876 TAGGGTAGCAAAATGGATGGTGG + Intronic
917856917 1:179108580-179108602 AAGGGTAAAGAGAAGAATGGTGG - Exonic
918042782 1:180923349-180923371 TATGGTAATGAGACGGCTGGTGG - Intronic
920654711 1:207867081-207867103 AAGGGTAACTAGAAGGATGGTGG - Intergenic
920792976 1:209110348-209110370 TATGCTAATGAGATGACTGGTGG + Intergenic
920951290 1:210573913-210573935 CAGGGAAATGAGAGGGATGAAGG + Intronic
922375437 1:224959271-224959293 TGGGGTAATGAGGAGGAGGGTGG - Intronic
922436740 1:225614700-225614722 TATGCTAATGAGATGACTGGTGG - Intronic
922514789 1:226199128-226199150 TGGGGTTCTGAGATGGATGATGG + Intergenic
922759982 1:228122457-228122479 TATGCTAATGAGTTGGCTGGTGG - Intergenic
923110239 1:230884436-230884458 TAGGATCATGAGAGGGATGTAGG + Intergenic
1064929932 10:20613854-20613876 TATGCTAATGAGATGACTGGTGG - Intergenic
1065268772 10:24004966-24004988 CAAGGAAAAGAGATGGATGGTGG + Intronic
1065452184 10:25870493-25870515 TAGGGTCAGGAGAGGGAAGGAGG + Intergenic
1067454260 10:46405027-46405049 TAGGGAGATGAAATGGAAGGAGG - Intergenic
1067632943 10:47979605-47979627 TAGGGAGATGAAATGGAAGGAGG + Intergenic
1068661951 10:59631835-59631857 TAGGGTAATGAAAATGTTGGTGG + Intergenic
1069084152 10:64120161-64120183 TAGTGTAATGAGCTGAATGATGG + Intergenic
1069254074 10:66310406-66310428 TAGGGTACAGAAATGGATCGTGG - Intronic
1069332973 10:67315356-67315378 TAGATTAATGAGAGGGGTGGAGG - Intronic
1070520714 10:77250648-77250670 GAAGGTAAGGAGATGGATGGAGG - Intronic
1071948095 10:90671122-90671144 TAGTGTCATGAGAGGGATGTTGG + Intergenic
1073718289 10:106135032-106135054 TAGGATAAGGAGATTGAAGGAGG + Intergenic
1078301921 11:10140216-10140238 TATGCTAATGAGATACATGGTGG + Intronic
1078516389 11:12026234-12026256 TATGCTAATGAGATGACTGGTGG - Intergenic
1079697381 11:23498673-23498695 TAGGGTTCTGATAAGGATGGAGG - Intergenic
1079772835 11:24485308-24485330 TAGGGTAGTGGGAAGGTTGGTGG - Intergenic
1081425194 11:42918877-42918899 TATGGTATTGAGGTGGAGGGTGG + Intergenic
1081814327 11:45930022-45930044 TAGGGTAATGAGATGGATGGTGG - Intronic
1084828932 11:71753165-71753187 TAGTGTAGTGAGTTGAATGGTGG - Intergenic
1086553664 11:88084113-88084135 TACGGCAATGAATTGGATGGGGG + Intergenic
1088039054 11:105354173-105354195 TATGCTAATGAGATGACTGGTGG - Intergenic
1090386027 11:126357974-126357996 TAGGGAAAGGAGCTGGCTGGGGG + Intronic
1090806083 11:130203179-130203201 CAGGGCAAAGAGCTGGATGGGGG + Intronic
1090917841 11:131181699-131181721 TAGGGGAATGTGATGGGTGAGGG - Intergenic
1093706053 12:22276017-22276039 CAGGGGAATGATATGGAGGGAGG + Intronic
1096205923 12:49721790-49721812 TTGGGTACTGATATGGTTGGTGG - Intronic
1096237678 12:49940690-49940712 TAGGGTAATGAGGTGGGCAGGGG + Intergenic
1097137919 12:56874980-56875002 TATGCTAATGAGATGACTGGTGG + Intergenic
1098296754 12:69011753-69011775 TACGCTAATGAGATGACTGGTGG - Intergenic
1098977012 12:76913310-76913332 TATGTTAGTGAGATGGCTGGTGG + Intergenic
1100366169 12:93922794-93922816 TTGGGTAAAGAGATGGGTGGAGG + Intergenic
1100457352 12:94765252-94765274 TAGGAGAACGAGATGGTTGGGGG - Intergenic
1103018276 12:117513099-117513121 GAGGGAAACGAGATGGAGGGAGG - Intronic
1103348086 12:120264758-120264780 CAGGGGAATGAGGTGGAAGGTGG - Intronic
1104098303 12:125581809-125581831 TGGGGTAATGATATGGAAGTGGG - Intronic
1107100572 13:36586504-36586526 TAGGGAAGAGAGATGGGTGGAGG - Intergenic
1107220732 13:37976514-37976536 TAGAATAGTGATATGGATGGAGG + Intergenic
1107325333 13:39235724-39235746 TATGATAATGAGATGACTGGTGG - Intergenic
1109602746 13:64654397-64654419 TAGAATATTGAAATGGATGGTGG - Intergenic
1110157505 13:72335550-72335572 TATGTTAATGAAAAGGATGGGGG + Intergenic
1110197094 13:72802510-72802532 TAGAGTCATGAATTGGATGGAGG + Intronic
1112105910 13:96239026-96239048 TAGGGCAATGATATGGACTGAGG + Intronic
1112180423 13:97073549-97073571 TAGGGAAATGGGATGGAGAGAGG - Intergenic
1112183187 13:97104902-97104924 TATGTTAATGAGATGGCTGGTGG - Intergenic
1112636055 13:101219308-101219330 TAGGGTAAGGGGAATGATGGAGG + Intronic
1116929260 14:50673636-50673658 TATGCTAATGAGATGACTGGTGG + Intergenic
1117461832 14:55952931-55952953 TAGGGGAATCAGATGGAGGTGGG + Intergenic
1119639212 14:76302110-76302132 TTGGGGAATGAGATGGATGATGG + Intergenic
1120456566 14:84738608-84738630 TATGCTAATGAGATGACTGGGGG + Intergenic
1120951018 14:90042025-90042047 TAGGGTATTAAGAGGGACGGAGG + Intronic
1121624507 14:95374436-95374458 TATGCTAATGAGATGACTGGTGG - Intergenic
1122091294 14:99342738-99342760 TAGGGGAAAGGGAGGGATGGGGG - Intergenic
1123398178 15:19957440-19957462 TTGGCTAATGGGATGGGTGGTGG + Intergenic
1124430767 15:29606148-29606170 TAAAGAAATGAAATGGATGGAGG - Intergenic
1125592047 15:40860652-40860674 AAGGCTCAGGAGATGGATGGTGG + Intergenic
1126412204 15:48383884-48383906 TATGCTAATGAGATGACTGGTGG - Intergenic
1127719144 15:61682930-61682952 TATGGTAATGTGTTGGATGGGGG - Intergenic
1128081337 15:64858857-64858879 GAGAGTTATGTGATGGATGGTGG - Intronic
1128619622 15:69137806-69137828 TACGCTAATGAGATGACTGGTGG + Intergenic
1128636663 15:69306771-69306793 AAAGGTATGGAGATGGATGGTGG - Intronic
1130287958 15:82571297-82571319 TGGGGTAAGGGGATGCATGGGGG - Intronic
1130583249 15:85157435-85157457 TATGCTAATGAGATGACTGGTGG - Intergenic
1131007317 15:88988386-88988408 TAGGTTTCTGAGATGGGTGGGGG - Intergenic
1133096616 16:3451338-3451360 TTGGGTACTGAGTTGGAGGGAGG + Intronic
1137283156 16:46995114-46995136 TATGCTAATGAGATGACTGGTGG + Intergenic
1138155968 16:54703033-54703055 GTGGGTAATGATATGGATGCTGG - Intergenic
1138308620 16:56003748-56003770 TATGTTAATGACATAGATGGTGG - Intergenic
1138985212 16:62320223-62320245 AAGGGTAGTGAGAGGGTTGGGGG - Intergenic
1140444280 16:75012288-75012310 AAGGATCATGAGATGGAAGGAGG + Intronic
1141319501 16:82994080-82994102 ATGGGTAATTAGATGGAGGGTGG - Intronic
1143197617 17:5088231-5088253 GATGGTAATTAGATGGACGGTGG - Intronic
1144031773 17:11329541-11329563 TGGGGTGAAGAGATGGGTGGCGG + Intronic
1144227102 17:13159916-13159938 TGGGGTAATGCAATGGATAGGGG - Intergenic
1144755806 17:17680119-17680141 TAAGGTATTGTGATAGATGGGGG - Intergenic
1146242846 17:31245964-31245986 TATGATAATGAGATGACTGGTGG - Intronic
1148236045 17:45969884-45969906 ATGGATAATGGGATGGATGGAGG - Intronic
1150634541 17:66903799-66903821 TAGGGTGGATAGATGGATGGTGG + Intergenic
1151949822 17:77345214-77345236 TGGGAAGATGAGATGGATGGTGG + Intronic
1152001971 17:77652201-77652223 TATGTTAATGAGATGACTGGTGG - Intergenic
1153215495 18:2816679-2816701 TATGCTAATGAGATGACTGGTGG + Intergenic
1153726913 18:7966285-7966307 AATGGTAATAACATGGATGGAGG - Intronic
1155215401 18:23639133-23639155 TAGTGAAATGGGATGAATGGTGG + Intronic
1157739941 18:50083455-50083477 TATGCTACTGAGATGGCTGGTGG - Intronic
1160223953 18:76998107-76998129 GAGGGTGTGGAGATGGATGGCGG - Intronic
1162156466 19:8681423-8681445 AAGGGTAATCAGATGCATGTGGG + Intergenic
1167345721 19:48944504-48944526 AAGGGTAAGGATATGGATGCGGG + Exonic
1167966227 19:53149566-53149588 TAAGCTAATGAGATGACTGGTGG + Intronic
1168451239 19:56468085-56468107 TATGCTAATGAGATGGCTGGTGG - Intronic
925626991 2:5851273-5851295 GAGGTGAGTGAGATGGATGGAGG - Intergenic
925948374 2:8887908-8887930 TAGAGTAAGGAAATGGAGGGAGG - Intronic
926208626 2:10852102-10852124 TAGGCTAATGAGATGATTGGTGG + Intronic
927195342 2:20542709-20542731 TGGGGCAGGGAGATGGATGGGGG + Intergenic
927593120 2:24373907-24373929 TATGCTAATGAGATGACTGGTGG + Intergenic
928534634 2:32228163-32228185 TAAAGTAATTAGATGGGTGGTGG + Intronic
930263765 2:49176373-49176395 TATGGGAATAAGATGGCTGGTGG + Intergenic
931418317 2:62102049-62102071 TACGCTAATGAGATGAGTGGTGG - Intronic
931609310 2:64081557-64081579 TTAGGCAATTAGATGGATGGTGG - Intergenic
932541487 2:72659009-72659031 TATGGTAATGAAAATGATGGTGG - Intronic
932723399 2:74157058-74157080 TATGCTAATGAGATGACTGGTGG + Intronic
932772076 2:74506068-74506090 TAGGGTAGTGAGGTGGCTGGTGG + Intronic
934942766 2:98514416-98514438 TATGCTAATGAGATGACTGGTGG + Intronic
935119900 2:100175377-100175399 TAGGGTAATAAGGTGTAGGGAGG - Intergenic
935399009 2:102640857-102640879 TATGCTAATGAGATGACTGGTGG - Intronic
936103192 2:109601267-109601289 TATGCTAATGAGATGACTGGTGG - Intronic
936603573 2:113924756-113924778 CAGGGGAATGAGAGGTATGGAGG - Intronic
938708531 2:133955294-133955316 TATGCTAATGAGATGACTGGTGG + Intergenic
939222369 2:139318929-139318951 TAGAATAAAGAGATGGGTGGGGG - Intergenic
940005901 2:149009435-149009457 TAGGGGACCCAGATGGATGGAGG - Intronic
943202615 2:184848197-184848219 TATGCTAATGAGATGATTGGTGG - Intronic
944114705 2:196173613-196173635 TAGGTAAATGAGGTGGATGGAGG - Intronic
944224266 2:197334514-197334536 AGGGGTAATGAAATGGATGGTGG - Intergenic
948122376 2:235540451-235540473 TAGGATAAAGAAATGGATTGAGG - Intronic
1169815463 20:9651529-9651551 AAGGTTAATGACATGGATGGTGG + Intronic
1173571868 20:44082223-44082245 TAGGGTAATGGGCTGGATCTTGG - Intergenic
1175372200 20:58499610-58499632 AAGGGCACTGAGGTGGATGGAGG - Intronic
1176015729 20:62930605-62930627 GAGGGAAATGAGATGGGAGGAGG + Intronic
1176744862 21:10642172-10642194 TTGGCTAATGGGATGGGTGGTGG + Intergenic
1177830622 21:26134767-26134789 TATGCTAATGAGATGACTGGTGG - Intronic
1178631841 21:34268285-34268307 ATAGGTAATGAGATGGAGGGGGG - Intergenic
1179500503 21:41805882-41805904 GAGGGTAATGATAGTGATGGAGG - Intronic
1179842329 21:44085207-44085229 TAGGCTAATGAGTTGATTGGAGG - Intronic
1182567954 22:31213414-31213436 GAGGGTATTGAGGTGGAGGGGGG + Intronic
1182593577 22:31400457-31400479 GAGGGAAATGAGCTGGATGGAGG + Intronic
1183204629 22:36410179-36410201 TAGGCTAATGAGACGGAAGTGGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
950726057 3:14917759-14917781 AAGAGTTCTGAGATGGATGGTGG - Intronic
951703083 3:25515721-25515743 TATGATAATGAGAAGAATGGTGG + Intronic
952964152 3:38610702-38610724 ATGGGAAATGGGATGGATGGGGG - Intronic
953324922 3:42004826-42004848 ATGGCTAAAGAGATGGATGGGGG + Intergenic
954633426 3:52058878-52058900 CAGGCTAATGTGAGGGATGGCGG - Intergenic
954736659 3:52713073-52713095 TATGCTAATGATATGGAAGGGGG - Intronic
955559175 3:60170190-60170212 CAGGTTAATAAGATGGATGGAGG + Intronic
956458017 3:69443039-69443061 TATGTTAATGAGATGGCTGGGGG + Intronic
957059335 3:75469401-75469423 TAGTGTAGTGAGCTGAATGGTGG + Intergenic
957206228 3:77202480-77202502 TAGGGAAATGAGCTGGGAGGAGG + Intronic
960009883 3:112822266-112822288 TATGCTAATGAGATGAGTGGTGG + Intronic
960658545 3:120032954-120032976 TGGGGTAATGAAATTGATTGGGG - Intronic
961112871 3:124299745-124299767 TATGATAATGATAAGGATGGAGG + Intronic
961294070 3:125869988-125870010 TAGTGTAGTGAGCTGAATGGTGG - Intergenic
961348567 3:126282549-126282571 TATGCTAATGAGATGACTGGTGG + Intergenic
961366765 3:126405090-126405112 AAGAGTTCTGAGATGGATGGTGG - Intronic
961489221 3:127240930-127240952 TAAGCTAATGAGATGATTGGTGG - Intergenic
961891860 3:130137145-130137167 TAGTGTAGTGAGCTGAATGGTGG + Intergenic
962235082 3:133700559-133700581 TAGGGTGATCAGATGGCTTGAGG + Intergenic
963312976 3:143728839-143728861 TCTGGCAACGAGATGGATGGTGG + Intronic
964345735 3:155752913-155752935 TAGGCTGATGGGATGCATGGGGG + Intergenic
964627868 3:158776610-158776632 CAGGGTACTGGGATGCATGGGGG - Intronic
968846423 4:3044755-3044777 TATGTTAATGAGGTGGCTGGTGG + Intergenic
969003244 4:3999581-3999603 TAGTGTAGTGAGCTGAATGGTGG + Intergenic
969750782 4:9108950-9108972 TAGTGTAGTGAGTTGAATGGTGG - Intergenic
969810682 4:9645238-9645260 TAGTGTAGTGAGCTGAATGGTGG - Intergenic
970512597 4:16795938-16795960 TGGGGTACTGAGAGGGAAGGAGG + Intronic
970910665 4:21271090-21271112 TAGGGTAAAGAGAAGGATCTTGG + Intronic
971834081 4:31738998-31739020 AAGGACAATGTGATGGATGGTGG + Intergenic
972732225 4:41806188-41806210 GAGGGGAAGGTGATGGATGGAGG + Intergenic
974400772 4:61403236-61403258 TAGGCTAATGAGATTAATAGTGG + Intronic
977114899 4:93011531-93011553 TATGCTAATGAGATTGCTGGGGG - Intronic
977307955 4:95348970-95348992 AAGGGTAGTGAGAGGGAGGGCGG + Intronic
977641637 4:99364061-99364083 AAGGGTAGTGAGAGGGATGGAGG - Intergenic
978744918 4:112182093-112182115 TATGGTGATGAGCTGGATGTGGG + Intronic
978886986 4:113775875-113775897 TAAGCTAATGAGATGACTGGTGG - Intergenic
978939781 4:114422553-114422575 TATGGTAATGAGATGACTGGGGG + Intergenic
979384474 4:120048181-120048203 AAGGTTATGGAGATGGATGGTGG + Intergenic
980172150 4:129302847-129302869 AAGGGTAATGGGTGGGATGGGGG + Intergenic
980720115 4:136684739-136684761 TAGGGAAAAGAGATGGAAAGGGG - Intergenic
981009241 4:139907979-139908001 TAGAATAAGCAGATGGATGGTGG + Intronic
981915020 4:150024256-150024278 TATGCTAATGAGATGACTGGTGG + Intergenic
983620740 4:169758315-169758337 TAGGGTAGGGAGAGGGATGGAGG - Intergenic
984500939 4:180557812-180557834 TAAAGTCATGAGATGGATAGAGG - Intergenic
985198380 4:187458447-187458469 TTGGGTAATTAGATGTATGATGG - Intergenic
987249138 5:16080691-16080713 TATGGTGATCAGCTGGATGGAGG - Intronic
987590437 5:19918892-19918914 TATGCTAATGAGATGTCTGGTGG + Intronic
987625577 5:20395693-20395715 TATGTTAATGAGATGACTGGTGG + Intronic
987724919 5:21685754-21685776 TATGCTAATGAGATGACTGGTGG + Intergenic
988494692 5:31734812-31734834 TATGCTAATGAGATGACTGGTGG - Intronic
990925205 5:61014045-61014067 TATGCTCATGAGATGGCTGGTGG + Intronic
991627657 5:68620836-68620858 TACCATAATTAGATGGATGGGGG + Intergenic
992426399 5:76662312-76662334 CAGGATAATGAGAGGAATGGAGG - Intronic
993077647 5:83254381-83254403 AAGGGTAATGAGGAGGAGGGTGG - Intronic
993503083 5:88683723-88683745 TAGGGTGCCGAGGTGGATGGTGG + Intergenic
995594585 5:113734237-113734259 TATGCTAATGAGATGACTGGTGG - Intergenic
996460941 5:123742352-123742374 TGGGATAATGAGATGGAAGAGGG + Intergenic
997662487 5:135600163-135600185 TAAAGTAATGAGGTAGATGGAGG + Intergenic
999243262 5:150139568-150139590 TCGTGGAATGAGATGGCTGGTGG - Intronic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1001335713 5:170795171-170795193 CAGGGTATGGAAATGGATGGGGG - Intronic
1001344368 5:170877626-170877648 GAGGTTAGGGAGATGGATGGGGG - Intronic
1002336469 5:178482511-178482533 AAAGGTTCTGAGATGGATGGTGG + Intronic
1003316937 6:5021534-5021556 AAGGGTAGTGAGAAGGAGGGAGG - Intergenic
1003733484 6:8851939-8851961 TAGGCTAGAGAGATGGATAGAGG - Intergenic
1004357032 6:14938774-14938796 TAGGGTTATGAGTTTGAAGGAGG + Intergenic
1004680791 6:17892518-17892540 TATGCTAATGAGATGACTGGTGG + Intronic
1004739727 6:18447129-18447151 AAGGGGAAAGAGATAGATGGGGG + Intronic
1005710299 6:28497981-28498003 TATGTTAATGAGATGACTGGTGG - Intergenic
1005875736 6:30008459-30008481 TGGGGTAAGGAGAGAGATGGGGG + Intergenic
1007019829 6:38508315-38508337 TGGGGTCATGGGAGGGATGGAGG - Intronic
1007206078 6:40152388-40152410 TAGGCTAATGAGATGACTAGTGG + Intergenic
1007316550 6:40993854-40993876 CAGGGTACTGGGAAGGATGGAGG - Intergenic
1007590767 6:43019494-43019516 GTGGGAAATGAGATGGAAGGAGG + Intronic
1008617093 6:53237141-53237163 GGGGGGAATGAGAAGGATGGAGG - Intergenic
1008819239 6:55610155-55610177 TAGGGTACAGAACTGGATGGAGG + Intergenic
1009462746 6:63933699-63933721 TATGTTCATGAGATGGCTGGTGG - Intronic
1010254651 6:73744132-73744154 TAGGTTCTGGAGATGGATGGTGG - Intronic
1010868429 6:81008702-81008724 TACGCTAATGAGATGACTGGTGG + Intergenic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015497708 6:133897996-133898018 CATGCTAATGAGATGGCTGGTGG - Intergenic
1015713285 6:136164492-136164514 TCTGTTTATGAGATGGATGGGGG - Intronic
1017832117 6:158140175-158140197 TATGCTAATGAGATGACTGGTGG + Intronic
1019160717 6:170065894-170065916 TGGGGGTATGGGATGGATGGGGG - Intergenic
1019160873 6:170066334-170066356 TGGAGTAATGGGGTGGATGGAGG - Intergenic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1020322198 7:6947685-6947707 TAGTGTAGTGAGCTGAATGGTGG + Intergenic
1021289182 7:18822266-18822288 TATGTTAATGAGATGACTGGGGG - Intronic
1021501758 7:21339501-21339523 CAGGGCAATGGGAGGGATGGGGG - Intergenic
1022802082 7:33786357-33786379 CAGGCTGCTGAGATGGATGGAGG + Intergenic
1024663027 7:51517523-51517545 AAGTGTAATGAGATGGATTAAGG + Intergenic
1026506504 7:70989097-70989119 TAGGTTAATGACCTGGGTGGGGG + Intergenic
1027699756 7:81455481-81455503 TAGGGTAATGACAGTAATGGTGG - Intergenic
1029263498 7:99320585-99320607 TATGCTAATGAGATGTCTGGTGG + Intergenic
1029960795 7:104687557-104687579 TATGCTAATGAGATGACTGGTGG - Intronic
1030081602 7:105783429-105783451 TATGCTAATGAGATGACTGGTGG + Intronic
1030757548 7:113307149-113307171 TAGGGTAACAATATGTATGGTGG + Intergenic
1030962420 7:115943229-115943251 GAGGGGAATGAGTGGGATGGTGG + Intronic
1034482382 7:151332498-151332520 TATGGTAATGAGTTGGCTGATGG + Intergenic
1034949239 7:155285852-155285874 AAGGGTCTGGAGATGGATGGTGG - Intergenic
1036373983 8:8184343-8184365 TAGTGTAGTGAGCTGAATGGTGG - Intergenic
1036876920 8:12481296-12481318 TAGTGTAGTGAGCTGAATGGTGG + Intergenic
1037826889 8:22165102-22165124 TAGGGAAATGAGCTCGCTGGAGG - Exonic
1039839297 8:41282047-41282069 TAGGGTGACGAGAGGAATGGAGG - Intronic
1040073487 8:43206755-43206777 TAGGGGAATGACAGAGATGGGGG - Intergenic
1042086880 8:65119295-65119317 TAGGTTAATGAGCTTGATTGTGG - Intergenic
1042489011 8:69377994-69378016 TATGCTAATGAGATGACTGGTGG - Intergenic
1042985011 8:74573834-74573856 AAGGCTAAAGACATGGATGGAGG - Intergenic
1043369123 8:79570869-79570891 TAGGGTAAAGAAATGTATGGAGG - Intergenic
1043549769 8:81357320-81357342 TACGGAGATGAGATGGATTGAGG + Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045290164 8:100826138-100826160 AAGGGTAATGGCAAGGATGGTGG - Intergenic
1047632303 8:126721632-126721654 TGGGGAAAAAAGATGGATGGTGG - Intergenic
1048611852 8:136031433-136031455 TAAGGTATTCAGATGGGTGGTGG - Intergenic
1051235267 9:14992885-14992907 TAGGGGAGGGAGAGGGATGGAGG + Intergenic
1053260963 9:36663521-36663543 AAGGGTGAGGAGATGGAAGGGGG - Intronic
1055045858 9:71923143-71923165 TATGGAAACCAGATGGATGGTGG - Intronic
1055359098 9:75469991-75470013 TAATTTAATGTGATGGATGGTGG - Intergenic
1056801204 9:89693256-89693278 TAGAGGAATGAAATGGATGGTGG + Intergenic
1057187536 9:93065299-93065321 TAGAATAATGAGATGCCTGGAGG - Intronic
1060733469 9:126051909-126051931 AAGGGAAATCAGATGGGTGGGGG - Intergenic
1061247914 9:129410642-129410664 TAGGGTGATGATAATGATGGTGG - Intergenic
1061445127 9:130633319-130633341 GAGGGAAAGGGGATGGATGGTGG - Intronic
1061622228 9:131818210-131818232 TATGCTAATGAGATGACTGGTGG + Intergenic
1062115971 9:134809109-134809131 TTGGGTAATGAGCTGGTGGGGGG + Intronic
1185469730 X:375156-375178 TAAGGAAGTGAGAAGGATGGAGG - Intronic
1186579569 X:10803024-10803046 TAGGGGAGAGAGAGGGATGGGGG + Intronic
1186747154 X:12581938-12581960 GAGGCTAATGAGAAGTATGGAGG - Intronic
1187488940 X:19731426-19731448 TTGAGTAATGAGATTGAAGGTGG - Intronic
1188737051 X:33729907-33729929 AAGGGTAATGGGATGGAGAGTGG - Intergenic
1189400515 X:40663901-40663923 TATGCTAATGAGATGGCTGATGG + Intronic
1189655158 X:43237194-43237216 TATGCTAATGAGATGATTGGTGG - Intergenic
1190106452 X:47564557-47564579 AAGGGTAATGAGAGGCATGACGG - Intronic
1190116236 X:47627657-47627679 GAGGGTAATGGGATGGAGGTGGG + Intronic
1192265078 X:69532148-69532170 TAGGGTGGTGGGGTGGATGGGGG - Exonic
1194313000 X:92338015-92338037 AAGGGTAGTGAGAGGGTTGGGGG + Intronic
1195118334 X:101722990-101723012 TATGCTAATGAGATGACTGGAGG + Intergenic
1195731829 X:107976246-107976268 GAGGGAAATGAGAGGGAGGGAGG + Intergenic
1195890601 X:109689318-109689340 TAGGGGTATGAGATGGAAGCAGG - Intronic
1196258518 X:113550857-113550879 TTGGGTAATGAGATAAATGAAGG - Intergenic
1196439050 X:115701987-115702009 TATGCTAATGAGATGACTGGTGG + Intergenic
1197651365 X:129068508-129068530 TTGGGTCAGGAGATTGATGGAGG - Intergenic
1199715564 X:150505326-150505348 TAGGGTGAAGGGATGGAGGGTGG - Intronic
1200153832 X:153964767-153964789 TTGGGGAATGAGAGGAATGGGGG - Intronic
1200246675 X:154530229-154530251 TAGGGAAAGGAGCTTGATGGGGG - Intergenic