ID: 1081814406

View in Genome Browser
Species Human (GRCh38)
Location 11:45930440-45930462
Sequence CTGCTGGTTGTACCTGACAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081814406_1081814408 -9 Left 1081814406 11:45930440-45930462 CCTATGTCAGGTACAACCAGCAG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1081814408 11:45930454-45930476 AACCAGCAGGCTTACCCCAAAGG 0: 1
1: 1
2: 2
3: 5
4: 110
1081814406_1081814411 2 Left 1081814406 11:45930440-45930462 CCTATGTCAGGTACAACCAGCAG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1081814411 11:45930465-45930487 TTACCCCAAAGGGCCTGATAAGG 0: 1
1: 0
2: 1
3: 8
4: 89
1081814406_1081814409 -8 Left 1081814406 11:45930440-45930462 CCTATGTCAGGTACAACCAGCAG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1081814409 11:45930455-45930477 ACCAGCAGGCTTACCCCAAAGGG 0: 1
1: 0
2: 0
3: 10
4: 91
1081814406_1081814417 27 Left 1081814406 11:45930440-45930462 CCTATGTCAGGTACAACCAGCAG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1081814417 11:45930490-45930512 GGAAGAAATCAAAACCCCAGAGG 0: 1
1: 0
2: 2
3: 32
4: 283
1081814406_1081814414 6 Left 1081814406 11:45930440-45930462 CCTATGTCAGGTACAACCAGCAG 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1081814414 11:45930469-45930491 CCCAAAGGGCCTGATAAGGAAGG 0: 1
1: 0
2: 0
3: 12
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081814406 Original CRISPR CTGCTGGTTGTACCTGACAT AGG (reversed) Intronic
901745869 1:11373103-11373125 CTGCTGGGTGATCCTGACACAGG + Intergenic
906091416 1:43182668-43182690 CTTCTGGTTCTACCTGCCTTTGG - Intronic
906411582 1:45583590-45583612 CTGCTGCTTGTACCCGTCCTCGG + Intergenic
908336861 1:63134859-63134881 GTGCTGTTTGGACCTGACAATGG + Intergenic
912741069 1:112197843-112197865 CTGCTGATTGTCCCTGTAATAGG - Intergenic
913019071 1:114768356-114768378 ATTCTGGTTGGACCTGACTTAGG + Intergenic
915000565 1:152585535-152585557 CTGGTGCTTGTGCCTGCCATTGG + Intronic
916173024 1:162015493-162015515 CTTCTGCTTTTACCTGACCTTGG - Intronic
917451563 1:175151597-175151619 GAGCTGGTTGTTCCTGACAGTGG + Intergenic
917494315 1:175526221-175526243 ATGCTGTTAGTACCTGACTTTGG - Intronic
923681331 1:236121142-236121164 CTGGTGGTTGCAGCTGACACTGG + Intergenic
1074489452 10:113926297-113926319 CTGCTGTTTCTTCCTGACATGGG - Intergenic
1076205425 10:128596619-128596641 CTGCAGGTAGTACCTGAGTTTGG + Intergenic
1076346434 10:129781836-129781858 CTTCTGAGTGTCCCTGACATAGG - Intergenic
1077716965 11:4591037-4591059 CTGCTGGTGGTACCTAACTATGG + Intergenic
1079419786 11:20275452-20275474 CTTCTGGTTGTCACTAACATGGG - Intergenic
1080253035 11:30257500-30257522 ATGTTGGTTTTAGCTGACATAGG - Intergenic
1081814406 11:45930440-45930462 CTGCTGGTTGTACCTGACATAGG - Intronic
1083663282 11:64261942-64261964 CTGCTTGTTGTATCTGAGATTGG - Exonic
1086991220 11:93305332-93305354 CTGATTGTTGTACCTGAAAGAGG + Intergenic
1087444412 11:98230565-98230587 ATGCTGCTTGTAACTGACATTGG - Intergenic
1091345240 11:134847860-134847882 CTTCTGGTTGTTCCTGATGTTGG + Intergenic
1092095834 12:5841237-5841259 CTCCAGGTTGTAGCTGACCTTGG - Intronic
1094095893 12:26704404-26704426 CTGTGTGTTATACCTGACATAGG + Intronic
1095557938 12:43529991-43530013 ATGCTGATTGTACCTAAAATTGG + Intronic
1104087435 12:125489167-125489189 CTGCTGGTGATATCTGAGATTGG - Intronic
1110638316 13:77791517-77791539 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
1111125015 13:83904115-83904137 GTACTGGTTGTCCCTGACTTAGG - Intergenic
1111578945 13:90197581-90197603 CTGCTGGTTTAACCGTACATTGG - Intergenic
1114026346 14:18530441-18530463 CTGACTGTTGTACCTCACATAGG + Intergenic
1118639109 14:67775949-67775971 CTGCTGGTTGGACAGGAGATTGG - Exonic
1119779392 14:77268305-77268327 CTGCTGTGTGGCCCTGACATGGG - Intronic
1132640447 16:975917-975939 CTCCTGGTTATACTTGAAATGGG + Intronic
1137758615 16:50922391-50922413 CTGCTGGCTGTCTCTGCCATTGG + Intergenic
1138279743 16:55763756-55763778 GTTCTGGTTCTACCTGTCATGGG - Intergenic
1138288759 16:55829893-55829915 GTTCTGGTTCTACCTGTCATGGG + Intronic
1138456431 16:57123646-57123668 CTGCTGGGTGTGCCTGAGTTGGG + Intronic
1140998055 16:80280094-80280116 CTGTTGGTTGTACTTGCCTTTGG - Intergenic
1141528189 16:84626940-84626962 CTGCTGGTAGGACATGACAGTGG + Intergenic
1145748648 17:27339498-27339520 CTGTGCTTTGTACCTGACATAGG - Intergenic
1147512350 17:41081776-41081798 CTCCTGGATGTGCCCGACATGGG - Intergenic
1147514523 17:41102947-41102969 CTCCTGGATGTGCCCGACATGGG - Intronic
1148595262 17:48849384-48849406 CTGCTGGTTATAGGTGACCTTGG + Intronic
1151139553 17:71978395-71978417 ATGCTGATTGTCCCTGGCATAGG - Intergenic
1151880001 17:76889125-76889147 CAGCTCGGTGTACCTGGCATGGG - Intronic
1156886506 18:42141464-42141486 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
1157582176 18:48779995-48780017 CTGCTGCTGGAACCTGTCATGGG - Intronic
1163584251 19:18155506-18155528 CTGCTGGCTGCACCAGACAAGGG - Exonic
1163769965 19:19185248-19185270 ATGCTGTTTGCACCTGACATGGG - Intronic
1164072170 19:21778193-21778215 CTGCTGCTGGTCCCTGATATGGG - Intergenic
1166089224 19:40497524-40497546 CTGCAGGTTGTAGTTGGCATTGG - Exonic
1166920661 19:46226973-46226995 CTGCTGGTTGTCAGTGACACAGG - Intergenic
1166960104 19:46492085-46492107 CATCTGGGTGTCCCTGACATAGG + Exonic
925121711 2:1423262-1423284 CTGCTGCTTGCACATGACACTGG - Intronic
925904076 2:8528887-8528909 CTGCAGAATGTCCCTGACATTGG - Intergenic
926221950 2:10942235-10942257 CTGCTCGTTGTCCCTGCCATGGG + Intergenic
927879191 2:26678727-26678749 CTGCTGGTTGTAGCTGAGTCAGG + Intergenic
930549548 2:52815170-52815192 CTGGTGCTTGTACTTGCCATTGG - Intergenic
934988977 2:98908047-98908069 CTGCATGTTCTACCTGACGTCGG - Intronic
940119682 2:150250296-150250318 CTCTTGGTTATACCTAACATGGG + Intergenic
941704602 2:168644580-168644602 CTCCTTGTTGTCCCTGGCATTGG + Intronic
942794799 2:179805240-179805262 CTGATGGTTGGTCCTGGCATAGG - Intronic
942947636 2:181686910-181686932 CTGCTGGGAGCACCTGCCATGGG + Intergenic
943912351 2:193584593-193584615 CTGGTGTTTGCACCTGCCATTGG + Intergenic
1171257556 20:23701600-23701622 CTGGTGCTTGTACCTGCTATTGG + Intergenic
1171264972 20:23763759-23763781 CTGGTGCTTGTACCTGCTATTGG + Intergenic
1171330306 20:24331544-24331566 CTGATGGCTGAACCTTACATTGG - Intergenic
1176657202 21:9597749-9597771 CTGCTGCTTGATCCTGACATCGG - Intergenic
1177200576 21:17950612-17950634 CCTCTAGTTCTACCTGACATTGG - Intronic
1178115228 21:29410127-29410149 GTGCATGTTGTACCTGATATAGG - Intronic
1179712412 21:43270982-43271004 CTGCTGGTTGCACGTGACTTTGG - Intergenic
1180450469 22:15457494-15457516 CTGACTGTTGTACCTCACATAGG + Intergenic
1184545268 22:45163489-45163511 CTGCTGGTCGTACCTGGCCGGGG - Intergenic
951895617 3:27607088-27607110 CTTCTGGATGTACCTTACCTAGG + Intergenic
956699896 3:71949601-71949623 CTGATGGTTGTTCATGTCATCGG + Intergenic
961644198 3:128383813-128383835 CTGCTGCTTTTACCTGAGACTGG - Intronic
965255693 3:166406913-166406935 CTGATAGTTTTACTTGACATGGG + Intergenic
966117003 3:176477004-176477026 CTGCTGGTAGTATCAGACCTGGG + Intergenic
966607247 3:181833900-181833922 CTTCTGTTTATACCTGAGATGGG + Intergenic
967834355 3:193948290-193948312 GTGCTGCTTATATCTGACATAGG + Intergenic
968861283 4:3172716-3172738 GTGCTGTTTGTACCTTAAATAGG - Intronic
970360245 4:15302130-15302152 TAGCTGGTTGAACCTCACATGGG + Intergenic
975192060 4:71475993-71476015 CTGTTGGTTGTACCTCTTATTGG + Intronic
975761011 4:77619707-77619729 CTGCTAGTTTCAGCTGACATTGG - Intergenic
977388141 4:96371364-96371386 CTGGTGCTTGCACCTGCCATAGG - Intergenic
980132301 4:128828044-128828066 CTACTGTTTGTGCCTGACAGTGG - Intronic
982146067 4:152394042-152394064 CTTCTAGCTGTATCTGACATAGG - Intronic
982447889 4:155515394-155515416 CTGCTAGTAATAACTGACATTGG + Intergenic
982458535 4:155639002-155639024 CTGCTGTTTGTACATGACATAGG + Intergenic
985418222 4:189758380-189758402 CTGCTGCTTGATCCTGACATCGG + Intergenic
990264241 5:54058641-54058663 CTGCTCCTTGAACCTGACACGGG - Intronic
993971868 5:94429727-94429749 CTGATGCCTGTGCCTGACATCGG - Intronic
997461263 5:134053990-134054012 CTGCTGTTTGTCACTGACAATGG + Intergenic
999111118 5:149122098-149122120 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
999586456 5:153094854-153094876 CTCCTGGTGGTATCTGGCATAGG - Intergenic
1000523150 5:162321971-162321993 CTTCTTCTTGTTCCTGACATGGG - Intergenic
1003461922 6:6337232-6337254 ATGCTGGTTGTTCTTAACATAGG + Intergenic
1004312195 6:14555403-14555425 CTGGTGTTTGTACCTGCCAGTGG + Intergenic
1008296569 6:49785805-49785827 CTGCTGCTTGTCCATTACATAGG + Intergenic
1010543770 6:77124631-77124653 CTGGTGATTGTGCCTGCCATTGG + Intergenic
1011299996 6:85863872-85863894 CTGCTGGTTTTAGCTGACTGTGG + Intergenic
1013146676 6:107400773-107400795 CTGGTGTTTGCACCTGCCATTGG + Intronic
1013356437 6:109349818-109349840 TTGCTGCCTGGACCTGACATTGG + Intergenic
1014420526 6:121238974-121238996 CTGCTGGTTGTAACTGAATATGG + Intronic
1016725877 6:147366538-147366560 CTGCTGGTATTCCTTGACATTGG + Intronic
1019600781 7:1882682-1882704 CTGCTGGGTGGGCATGACATGGG + Intronic
1021189486 7:17603220-17603242 CTGGTGCTTGTGCCTGCCATTGG + Intergenic
1021823615 7:24523425-24523447 CAGCTGAATGTACCTGAAATGGG + Intergenic
1022259884 7:28693972-28693994 CTTCTGGCTGTACATGCCATTGG + Intronic
1022611925 7:31884526-31884548 CTGCAGCTTGTATCTGACATGGG - Intronic
1028439697 7:90845951-90845973 CTGCTGGATGAACCTTACAGAGG + Intronic
1032516363 7:132509107-132509129 CTGCTGGTGGCACCTGACCCGGG - Intronic
1035936617 8:3848187-3848209 CTTCTGATTGTTCCTGACATTGG - Intronic
1039421156 8:37442244-37442266 CTGCTGGTGGTACCTCTGATGGG + Intergenic
1039425873 8:37485571-37485593 CTGCTGCTTGGACCTGAGATGGG - Intergenic
1039426162 8:37488039-37488061 CTGCTGCTTGGGCCTGAGATGGG - Intergenic
1041887706 8:62830869-62830891 CTGATGCTTGTGCCTGCCATTGG + Intronic
1047707775 8:127517878-127517900 CTGCTGGCTGTACATGAAACAGG - Intergenic
1047870464 8:129076646-129076668 CTGCTATTTGTACATAACATAGG + Intergenic
1048271164 8:133029377-133029399 CAGGTGGTTGTCCCTGACAATGG - Intronic
1052757175 9:32552658-32552680 CTGCTGGGTGTACCCGCCACTGG + Intergenic
1056492770 9:87124162-87124184 CTGTTAGTTTTACCTGAAATCGG + Intergenic
1060589913 9:124810213-124810235 CTGCTGGTTGTACGTGTCCACGG - Exonic
1061487994 9:130929973-130929995 CTGCTGGCTGTAGCTGTCACCGG - Exonic
1203495624 Un_GL000224v1:148566-148588 CTGATGGTTGACCCTCACATAGG - Intergenic
1203497699 Un_GL000224v1:167926-167948 CTGATAGTTGTCCCTCACATAGG - Intergenic
1203508249 Un_KI270741v1:90489-90511 CTGATGGTTGACCCTCACATAGG - Intergenic
1203634924 Un_KI270750v1:101323-101345 CTGCTGCTTGATCCTGACATTGG - Intergenic
1191615734 X:63167690-63167712 CTGTTGCTTGTGCCTGTCATTGG + Intergenic
1191620564 X:63211233-63211255 CTGTTGCTTGTGCCTGTCATTGG - Intergenic
1194001886 X:88439854-88439876 CTTCAGTTTGAACCTGACATTGG + Intergenic
1197285725 X:124593126-124593148 CTGGTGCTTGTGCCTGACATTGG - Intronic