ID: 1081814732

View in Genome Browser
Species Human (GRCh38)
Location 11:45932215-45932237
Sequence TTCCCTCGGAGGTGTCCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 98}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081814722_1081814732 28 Left 1081814722 11:45932164-45932186 CCCTCCTGTCACGGCCAGGGTGC 0: 1
1: 0
2: 0
3: 12
4: 119
Right 1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1081814727_1081814732 -2 Left 1081814727 11:45932194-45932216 CCACAGAGCTCCGCTGGCCAGTT 0: 1
1: 0
2: 1
3: 6
4: 126
Right 1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1081814723_1081814732 27 Left 1081814723 11:45932165-45932187 CCTCCTGTCACGGCCAGGGTGCG 0: 1
1: 0
2: 1
3: 6
4: 80
Right 1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1081814725_1081814732 14 Left 1081814725 11:45932178-45932200 CCAGGGTGCGTGCGCACCACAGA 0: 1
1: 0
2: 0
3: 4
4: 74
Right 1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 98
1081814724_1081814732 24 Left 1081814724 11:45932168-45932190 CCTGTCACGGCCAGGGTGCGTGC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081814732 Original CRISPR TTCCCTCGGAGGTGTCCCCC AGG Intronic
900372042 1:2336492-2336514 TGCCGTGGGTGGTGTCCCCCTGG + Exonic
900605429 1:3521599-3521621 TTGCCTGGGAGGTGGCCCCCAGG + Intronic
900794610 1:4700525-4700547 TTCCCTTTGAGCTGACCCCCAGG + Intronic
901256255 1:7829892-7829914 CTCCCTGGGAGGTGACCCCGTGG - Exonic
901256299 1:7830108-7830130 TTCGCTGGGAGGTGACCCCGTGG - Exonic
902282454 1:15384422-15384444 TTCCCGAGGCAGTGTCCCCCAGG + Intronic
903321907 1:22548330-22548352 ATCCCTCGGAGCTGTCACCGAGG + Intergenic
907707497 1:56845488-56845510 TTCCCTCCGGGGAGTCCCCAAGG + Intergenic
909111723 1:71487316-71487338 TTCCCTCACAGCTGTCTCCCAGG + Intronic
910935666 1:92483575-92483597 TTCCCTCTCAGGTCTCCTCCGGG - Exonic
914225986 1:145719906-145719928 TTCCCCCGGAGGTGCCTCACAGG - Intronic
1063103612 10:2973423-2973445 TTCCCTGAAAGGTGTCCCCAGGG + Intergenic
1063155511 10:3375718-3375740 TCCGCTGGGAGGTGTCCTCCAGG - Intergenic
1063429781 10:5978031-5978053 TGCCCGCGGAGGTGTCGCCGCGG + Intronic
1066049191 10:31619242-31619264 TCCCCTCCGAGGTGGCTCCCGGG - Intergenic
1075975037 10:126687362-126687384 TCCCCTCTCATGTGTCCCCCGGG + Intergenic
1077205028 11:1337769-1337791 GTCCCCCGGAGGCGCCCCCCAGG - Intergenic
1081705164 11:45178602-45178624 GTCCCTCTGATGTGTCCCACTGG - Intronic
1081814732 11:45932215-45932237 TTCCCTCGGAGGTGTCCCCCAGG + Intronic
1093231444 12:16548593-16548615 CTCCATCGGAGGTGTCCTACTGG + Intronic
1096156201 12:49342657-49342679 TTCCCTAGGAGGGGTCGCCCTGG - Intergenic
1104942026 12:132399700-132399722 TGCCCTCTGAGGTGACGCCCAGG + Intergenic
1104996439 12:132660765-132660787 TTCCCTCAGAGTTGTGTCCCTGG + Intronic
1106460781 13:29965774-29965796 TTCCCTTGGGGGTGGCCCCATGG + Intergenic
1108247648 13:48533281-48533303 TCCCCTCGGAGTTGACCCCCGGG + Intergenic
1113952729 13:114080712-114080734 TGCCCTGGGAGGTGGCCCCTGGG - Intronic
1118317051 14:64731847-64731869 GTCCCACGCAGGTGTCCCCTGGG - Intronic
1119484306 14:74978056-74978078 TTCCCTGGGAGGTCTGACCCAGG + Intergenic
1122113269 14:99515852-99515874 TTCCCTGGGTGCTGGCCCCCGGG - Intronic
1122401346 14:101469368-101469390 TTCCCTGTGAGGTGGCCGCCAGG + Intergenic
1122878823 14:104680810-104680832 TTCCCGGGGAGGTGGCTCCCGGG - Intergenic
1132513336 16:354456-354478 TTCCCTGGGCTGTGTCACCCTGG + Intergenic
1133058829 16:3161189-3161211 GTCACTCGGAGGAGTCCCTCAGG - Intergenic
1133526565 16:6611479-6611501 TTCCCTCGGAGAGGTCTCCTTGG + Intronic
1135473302 16:22751455-22751477 TTCCCTTGCAGCTGTCCACCGGG - Intergenic
1135813201 16:25608500-25608522 TTCCCTCGGAGTTAGCCCCTAGG - Intergenic
1148158192 17:45435355-45435377 TCCCCTTGGAGGGGTCCCCTGGG + Intergenic
1148621142 17:49035672-49035694 TGCCCTCCGAGGTCTCCCCTGGG + Intronic
1151339102 17:73458361-73458383 TTCCCTCCCAGGCATCCCCCAGG + Intronic
1151757507 17:76083115-76083137 TTCCCTCCCAGGAGTCCCCTAGG - Exonic
1152071795 17:78137804-78137826 CTGCCTCGGAGGTGAGCCCCGGG + Exonic
1152571409 17:81122838-81122860 TTGCCTCTGACGTGGCCCCCGGG - Intronic
1159643235 18:70887951-70887973 TCCACTAGGAGGTGTCCCACTGG - Intergenic
1160011172 18:75107990-75108012 TTCCATCTGAGTTGGCCCCCCGG + Intergenic
1160947667 19:1651267-1651289 CAGCCTCGGAGGTGTCTCCCGGG - Intronic
1161060640 19:2213130-2213152 TTCCCTTGGAGGTGGGCCTCCGG + Intronic
1161073414 19:2273605-2273627 CTCCCACGGAGGAGACCCCCTGG + Intronic
1163128487 19:15257426-15257448 TTGCCTGGGCGGTGTCCTCCAGG - Intronic
1163756984 19:19111994-19112016 GTCTCTCAGAGGAGTCCCCCAGG + Exonic
1165423255 19:35732606-35732628 CCTCCTCGGAGCTGTCCCCCGGG - Exonic
1166558913 19:43719232-43719254 TTCCCACGCTGGTGTCCACCTGG + Exonic
929026935 2:37614071-37614093 TTCCCTCACTGGTTTCCCCCAGG + Intergenic
930749229 2:54916794-54916816 TTCCCTCACAGGTGGGCCCCAGG - Exonic
935720302 2:105973660-105973682 CTCCCTCTCAGGTGTCCACCAGG + Intergenic
948451817 2:238080462-238080484 TTCCCCAGGAGGTGTCTCCCAGG + Intronic
1168898103 20:1337909-1337931 TTCCCACAGAGAAGTCCCCCAGG + Intronic
1169921515 20:10739380-10739402 GTCCTTCTGAGGTGTCCCACAGG - Intergenic
1171159544 20:22908888-22908910 TTATCTGGGAGGTGACCCCCAGG - Intergenic
1172095688 20:32458994-32459016 TTGCCTCGGGGCTGTGCCCCCGG + Intronic
1172199019 20:33112363-33112385 GTCCCTAGGAGGGGTCCCCTGGG - Intergenic
1176549636 21:8215541-8215563 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
1176557527 21:8259770-8259792 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
1176568561 21:8398575-8398597 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
1176576472 21:8442804-8442826 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
1177640690 21:23840715-23840737 TTCACTCGAAGGTGACCCACTGG - Intergenic
1181510556 22:23386976-23386998 TCCCCTCGGGGGTGCCCCACAGG + Intergenic
1184468355 22:44682005-44682027 TTCCCTCTGTGCTGTCTCCCAGG - Intronic
1203254522 22_KI270733v1_random:131862-131884 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
1203262578 22_KI270733v1_random:176941-176963 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
950117413 3:10460314-10460336 TTCCCTGGGAGCTGTCCTCAAGG + Intronic
955117279 3:56018081-56018103 ATACCTAGGAGGTGTCCCCAAGG + Intronic
961653402 3:128428708-128428730 TTCACTCGCAGGTTTCCTCCTGG + Intergenic
965080320 3:164024387-164024409 TTCCCCCGGAGGAACCCCCCTGG - Intergenic
965997280 3:174899437-174899459 TCCCCTTGGTGGTGTCCTCCAGG + Intronic
968439686 4:617039-617061 GTCCCCCCGTGGTGTCCCCCAGG + Intergenic
969697128 4:8741162-8741184 TTTCATTGGAGGTGTCTCCCAGG + Intergenic
978930786 4:114309063-114309085 TTCACTCAGTGATGTCCCCCAGG - Intergenic
984033103 4:174629795-174629817 TCCCCTCACAGGTGTCCCTCTGG + Intergenic
984723085 4:182994722-182994744 TTCACTCGATGGTGTTCCCCAGG - Intergenic
985714689 5:1448665-1448687 TTCCTCCTGAGGTGGCCCCCGGG - Intergenic
990754439 5:59052746-59052768 TTCCCTAGAAGGTGGCCTCCAGG + Intronic
998061054 5:139119050-139119072 TTCCCTTGGAGTTGTCCCAAAGG - Intronic
1003869078 6:10387637-10387659 TTCCCTCCCAGCTCTCCCCCTGG + Intergenic
1018837460 6:167496083-167496105 TTGCCTTGGAGATGTCCCCAGGG - Intergenic
1020020093 7:4861060-4861082 TTTCCTCGGAGGTGTTTCCTGGG - Exonic
1022671818 7:32462868-32462890 AGCCCTGGGAAGTGTCCCCCTGG - Intergenic
1024220782 7:47284875-47284897 CTCCCTCGGCCGTGTCCTCCTGG + Intronic
1029507547 7:100971444-100971466 TTACCTCGAAGGTGTCCTGCAGG - Intronic
1029626962 7:101725922-101725944 TTCCCTCGGAGGGGCCCCTTGGG - Intergenic
1035115259 7:156518368-156518390 GTCCCTCTGGGGTGTCCACCAGG - Intergenic
1037401290 8:18497535-18497557 TTCCCTAGGAGGTGTGATCCCGG - Intergenic
1037890610 8:22622073-22622095 TGGCCTCTGAGCTGTCCCCCTGG - Intronic
1050935973 9:11395338-11395360 TTCCCACAGAGGTTTCCACCTGG - Intergenic
1056912878 9:90719161-90719183 TTCTCTCTGTGGTGACCCCCAGG - Intergenic
1060662824 9:125414361-125414383 GTCCCTCGCAGGTGGCCCCGTGG + Intergenic
1061679890 9:132237791-132237813 TCCCCTGGGAGGTGTGGCCCTGG + Intronic
1061927072 9:133811129-133811151 ATCCCTCGGGGGAGACCCCCCGG + Intronic
1203785799 EBV:126798-126820 TTCCCTCGGTGGTGTCCTGCCGG + Intergenic
1203470923 Un_GL000220v1:115006-115028 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
1203478744 Un_GL000220v1:158978-159000 TTCCCTCCGAAGTTTCCCTCAGG + Intergenic
1190215807 X:48478689-48478711 TTACCTGGGTGATGTCCCCCTGG - Exonic
1191605511 X:63057911-63057933 TTCCCTCGAAGCTGCCCGCCTGG - Intergenic
1195313823 X:103658633-103658655 ATACCTCTGAGGTGTCCCCTTGG - Intergenic
1199699424 X:150364821-150364843 TTCCCGCGGGGGTCTACCCCGGG - Intronic
1200214559 X:154361903-154361925 GTCCCTCGGAGCTGTCCCCTAGG + Intronic