ID: 1081825926

View in Genome Browser
Species Human (GRCh38)
Location 11:46051693-46051715
Sequence GTCCTCACCCCCTTGAGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 132}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081825926_1081825928 0 Left 1081825926 11:46051693-46051715 CCTCAACTCAAGGGGGTGAGGAC 0: 1
1: 0
2: 0
3: 18
4: 132
Right 1081825928 11:46051716-46051738 ACTGGTCTCTGCTACCACGAAGG 0: 1
1: 0
2: 5
3: 72
4: 515
1081825926_1081825931 23 Left 1081825926 11:46051693-46051715 CCTCAACTCAAGGGGGTGAGGAC 0: 1
1: 0
2: 0
3: 18
4: 132
Right 1081825931 11:46051739-46051761 AAGATATTAGAGGAAGACAAAGG 0: 1
1: 0
2: 1
3: 42
4: 588
1081825926_1081825932 28 Left 1081825926 11:46051693-46051715 CCTCAACTCAAGGGGGTGAGGAC 0: 1
1: 0
2: 0
3: 18
4: 132
Right 1081825932 11:46051744-46051766 ATTAGAGGAAGACAAAGGATTGG 0: 1
1: 0
2: 1
3: 26
4: 369
1081825926_1081825929 13 Left 1081825926 11:46051693-46051715 CCTCAACTCAAGGGGGTGAGGAC 0: 1
1: 0
2: 0
3: 18
4: 132
Right 1081825929 11:46051729-46051751 ACCACGAAGGAAGATATTAGAGG 0: 1
1: 0
2: 1
3: 4
4: 80

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081825926 Original CRISPR GTCCTCACCCCCTTGAGTTG AGG (reversed) Intronic
900340029 1:2183983-2184005 GTCCTCACCCGTATGTGTTGTGG + Intronic
902820250 1:18939050-18939072 GTCCTCTCCCCTTGGAGGTGAGG + Intronic
905629550 1:39511062-39511084 GTCCGCTCCACCTTGAGTGGTGG + Intronic
905668210 1:39775128-39775150 GTCCGCTCCACCTTGAGTGGTGG - Intronic
912985889 1:114430160-114430182 TTCCCCACCCCCTTAAGATGGGG - Intronic
913320666 1:117586314-117586336 ATCCTCACCCCTTTGACTTTGGG + Intergenic
914506599 1:148295186-148295208 TGCCTCACCCCCCTGAGATGTGG - Intergenic
915529494 1:156495088-156495110 GCCCTCACACCCTTGCTTTGGGG + Intronic
917173215 1:172201291-172201313 ATCCTCTCCCCCTTGAGTGCTGG + Intronic
917259000 1:173147601-173147623 TTCCTCTCCCCCTTGAGTGCTGG + Intergenic
919260826 1:195191189-195191211 CTCCTCTCCCCCTTGAGTACTGG - Intergenic
921012882 1:211160859-211160881 TTCCTCTCCCCCTTGAGTGTTGG + Intergenic
923148522 1:231214338-231214360 GTCCTCCTCCCCTTGGGATGGGG + Intronic
1066313611 10:34221757-34221779 GTCCCCACACCCTTGACTTTTGG - Intronic
1066450340 10:35522618-35522640 ATCCTCACCCTCTTTAGTTTTGG - Intronic
1067460147 10:46452229-46452251 GCCATCACCCACTTGAGTTTGGG + Intergenic
1067627043 10:47932374-47932396 GCCATCACCCACTTGAGTTTGGG - Intergenic
1076749458 10:132535406-132535428 GGCCGCACCCCCTTGGGTTCTGG + Intergenic
1080017314 11:27521132-27521154 TTCCACACCCCTTTGAGTTAAGG + Intergenic
1081825926 11:46051693-46051715 GTCCTCACCCCCTTGAGTTGAGG - Intronic
1084261864 11:67984200-67984222 GGCCTCACCCCCTTGCGATGGGG + Intergenic
1084621240 11:70271226-70271248 GTCCTCACCCCCCGGGGTTCGGG + Intronic
1086569059 11:88262499-88262521 TTCCTCTCCCCCTTGAGTGCTGG + Intergenic
1090945808 11:131428601-131428623 GTCTTCATCCCCTAGACTTGAGG + Intronic
1092435695 12:8445258-8445280 GGCCTCACCCCCTTGCGATGGGG + Intergenic
1092435725 12:8445337-8445359 GGCCTCACCCCCCTGCGATGGGG + Intergenic
1093758849 12:22882471-22882493 GAGCTAACTCCCTTGAGTTGAGG - Intergenic
1096607583 12:52777679-52777701 GTCCTCACCCCCCTGTGTCAGGG - Intergenic
1097767808 12:63545440-63545462 CTCCTCACCTCCTTGATTTTGGG + Intergenic
1107544902 13:41426249-41426271 GACCTCACCCCCTTGCGATGGGG + Intergenic
1110034953 13:70672199-70672221 TTCCTCTCCCCCTTGAGTGCTGG + Intergenic
1111941643 13:94614591-94614613 TTCCTCAACATCTTGAGTTGTGG + Intronic
1114270334 14:21097239-21097261 GTCCTCACTCTCCTGAGTTAGGG + Intronic
1117041356 14:51772165-51772187 GGCCTCACCCCCTTGTGATGGGG + Intergenic
1123205209 14:106705846-106705868 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123205218 14:106706023-106706045 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123205230 14:106706317-106706339 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123205233 14:106706376-106706398 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123205236 14:106706435-106706457 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210197 14:106752169-106752191 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210207 14:106752346-106752368 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210210 14:106752405-106752427 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210213 14:106752464-106752486 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210216 14:106752523-106752545 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210248 14:106753112-106753134 GTCCTCATCGCCTTGAATTGTGG + Intergenic
1123210252 14:106753171-106753193 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210258 14:106753289-106753311 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210266 14:106753466-106753488 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210277 14:106753643-106753665 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1123210284 14:106753761-106753783 GTTCTCATCGCCTTGAATTGTGG + Intergenic
1130427087 15:83812232-83812254 GTCCTCTCCCACTTGAGGTGGGG - Intronic
1134601570 16:15537769-15537791 TGCCTCAGCCCCTTGAGTAGTGG + Intronic
1143642785 17:8208827-8208849 GTGCTAAACCCCTTGAATTGTGG - Intronic
1146751815 17:35389057-35389079 CTCCTCTCCCACTTGAGTTCTGG + Intergenic
1147486438 17:40819156-40819178 GACCTCACCCCGTTTAGTTCCGG - Exonic
1150309534 17:64116733-64116755 GTTCTGACCCCTCTGAGTTGTGG + Intronic
1150463363 17:65371380-65371402 GTCCTCTCTCCCATGAGGTGTGG + Intergenic
1152049628 17:77962076-77962098 GACCTCATCCCCTTCAATTGGGG - Intergenic
1152247302 17:79191700-79191722 GTCCCCACTCCCTTGAGTCCTGG - Intronic
1154181275 18:12142076-12142098 TTCCTCTCCCCCTTGAGTGCTGG + Intergenic
1154182629 18:12149508-12149530 TTCCTCTCCCCCTTGAGTGCTGG - Intergenic
1157161635 18:45318919-45318941 GTCCTCATCCCCATGAGCTCAGG - Intronic
1160949515 19:1658716-1658738 GTTCTCACCCCTTGGGGTTGGGG - Intergenic
1161001244 19:1912312-1912334 GGCCGCACCCGCTTGAGGTGAGG - Exonic
1161613343 19:5256473-5256495 GTCCTCATCCCCCAGAGGTGGGG - Intronic
1163106399 19:15125330-15125352 GTCGTCGCCACCTTGACTTGTGG - Intronic
1165355004 19:35299255-35299277 GTCCTCACCCTCTCGCTTTGCGG + Intronic
1165760820 19:38320284-38320306 GTCCTCGCCGCCTTGCGGTGAGG - Intronic
928462083 2:31484753-31484775 TTCCTCTCCCCCTTGAGTGCTGG + Intergenic
932352464 2:71043601-71043623 GGCCTCACCCCCCTGCGATGGGG - Intergenic
932352495 2:71043679-71043701 GGCCTCACCCCCTTGCGATGGGG - Intergenic
933484269 2:82897557-82897579 CTCCTCTCCCCCTTGAGTGCTGG - Intergenic
945649067 2:212537791-212537813 GCCCTCTCCCCATTGACTTGAGG - Intronic
1169987678 20:11463411-11463433 GTCCTCACGGCCATGAGTTTAGG - Intergenic
1171878997 20:30602887-30602909 GTCATCACCCACTTGTTTTGTGG - Intergenic
1173385376 20:42582483-42582505 GGACTCACCCCCTTGACCTGTGG - Intronic
1174365385 20:50053405-50053427 CTCCACACCGCCCTGAGTTGGGG + Intergenic
1175469767 20:59219230-59219252 TTCCTAACCTCCTTGAGGTGAGG - Intronic
1176139666 20:63539455-63539477 GTCCTTGTCCCCTAGAGTTGGGG - Intergenic
1185376212 22:50483661-50483683 GGTCTCACCCCCTTCAGGTGAGG - Exonic
951753346 3:26061453-26061475 TTCCTCTCCCCCTTGAAATGAGG - Intergenic
953579529 3:44141321-44141343 GTCCTCCTCCCCTGGAGTCGTGG + Intergenic
953847964 3:46443840-46443862 GTCATCACAGCCTTGAGCTGGGG + Intronic
953848322 3:46446161-46446183 TTCCTCATCCCCATGAGGTGGGG + Intronic
955802066 3:62696591-62696613 GCCCCCATCCCCTAGAGTTGAGG - Intronic
957076933 3:75609783-75609805 GGCCTCACCCCATTGCGATGGGG + Intergenic
957079513 3:75624011-75624033 TTCCTCACCCCCCTGCGATGGGG + Intergenic
960505232 3:118485826-118485848 GTCTTCATCGCCTTGAGTTTGGG - Intergenic
960685345 3:120288756-120288778 TTCCTCTCCCCCTTGAGTGCTGG - Intergenic
961651044 3:128416777-128416799 GCCCTCACCCCTTTGTGCTGTGG - Intergenic
961735199 3:128997058-128997080 GTCTTCATCCCCTTGAAGTGGGG - Intronic
963163299 3:142174739-142174761 GTACTCACCCTCTGCAGTTGTGG - Intronic
968989331 4:3898333-3898355 GCCCTCACCCCCCTGCGTTGTGG + Intergenic
969020366 4:4136007-4136029 GGCCTCACCCCCCTGCGATGGGG + Intergenic
969733495 4:8971416-8971438 GGCCTCACCCCCTTGCGATGGGG - Intergenic
969793091 4:9505480-9505502 GGCCTCACCCCCTTGCGATGGGG - Intergenic
970693820 4:18651419-18651441 GCCCTCACCCCTTTCAGTTGTGG - Intergenic
971352191 4:25863886-25863908 GGCCTCACCCCTTTCATTTGGGG - Intronic
972396645 4:38664076-38664098 GTCCCCACCCACTTGGGTGGAGG - Intergenic
974109460 4:57510488-57510510 CTCCTCTCCCACTTGAGTTCTGG + Intergenic
975196897 4:71536252-71536274 CCCCTCACCCCCTTGAATGGAGG - Intronic
975467706 4:74728119-74728141 CTTCTCAACCCCTTAAGTTGTGG - Intergenic
978683656 4:111414387-111414409 CTCCTCTCCCCCTTGAGTGCTGG + Intergenic
982536803 4:156617132-156617154 GGCCTCACTCCCATGAGTAGTGG - Intergenic
984434854 4:179696405-179696427 ATCCTCATCCCCTTGAATTTGGG - Intergenic
985861321 5:2472910-2472932 GTCTTCACCCCTTTGACTTCAGG - Intergenic
990941927 5:61211120-61211142 GTCCTCACCCACTTGTATTTTGG + Intergenic
996382810 5:122878860-122878882 TTCCTCAGCCTCTTGAGTAGTGG - Intronic
999412545 5:151365056-151365078 GTGCTCACTTCCTGGAGTTGGGG + Intergenic
1001295541 5:170496224-170496246 GTCCCCAGCCCTTTGAGTGGTGG - Intronic
1002617349 5:180464104-180464126 GTGCTCACCCCTGTGAGGTGGGG - Intergenic
1003180676 6:3788768-3788790 GTCCTCACCCCAGTGGGTAGGGG + Intergenic
1008973814 6:57401529-57401551 GTCCTCTCCCCTTTGAGTGCTGG + Intronic
1009326097 6:62349102-62349124 GTCATCTCCCCTTGGAGTTGTGG - Intergenic
1009575760 6:65456994-65457016 TTCTTTACCCCCTTGAGTTTAGG + Intronic
1009834772 6:68985509-68985531 TTCCTCACCCCCTTGATGTTAGG + Intronic
1010666711 6:78639324-78639346 GTCACCACCCCCTTGAATGGTGG - Intergenic
1011498504 6:87962490-87962512 ATCCACCCCCCCTTGAGTGGGGG + Intergenic
1016774192 6:147886504-147886526 ATCCTCTCCCCCTTGAGTGTGGG + Intergenic
1017345065 6:153370355-153370377 TTCCTCTCCCCCTTGAGTGCTGG - Intergenic
1020307773 7:6848031-6848053 GGCCTCATCCCCTTGCGATGGGG + Intergenic
1020312176 7:6876443-6876465 GCCCTCACCCCCCTGCGATGTGG + Intergenic
1021971143 7:25967084-25967106 GTCCTCAGCCCCTTGCTATGTGG - Intergenic
1022046661 7:26627338-26627360 GTCCTGACCTCCTTGAGATCTGG + Intergenic
1025097789 7:56110616-56110638 GTCCCTATCCCCTTGAGTGGGGG + Intergenic
1029052262 7:97701068-97701090 TTCCTCTCCCCCTTGAGTGCTGG - Intergenic
1029078895 7:97956971-97956993 GGCCTCACCCCCTTGCGATGGGG + Intergenic
1031693975 7:124826256-124826278 GTCCTCTCCCCATAGAGTTGTGG - Intronic
1032985276 7:137330560-137330582 GTCCTCCCCACCTTTAGTGGTGG - Intronic
1036238725 8:7064914-7064936 GCCCTCACCCCCCTGTGATGTGG - Intergenic
1039061651 8:33576620-33576642 GTTCTCACCCCCTTGAGCTTGGG + Intergenic
1042227681 8:66526772-66526794 GCCCACATCCCCTTGAGTTCTGG - Intergenic
1049398570 8:142413207-142413229 GCCATCACACCCTTGAGTTTTGG - Intergenic
1049604787 8:143524239-143524261 GTCCCCACCTGCTGGAGTTGTGG - Intronic
1049959193 9:721987-722009 GTCCCCACCCCCTTGGGTTTCGG - Intronic
1050244525 9:3673866-3673888 GTCCTCACCTTCTAGAGTTAAGG - Intergenic
1052626531 9:30982595-30982617 TTCCTCTCCCCCTTGAGTGCTGG - Intergenic
1053045054 9:34908687-34908709 GTCCTCAACCCCTTGTGTACTGG - Intergenic
1055225097 9:73985480-73985502 TTCCTCTCCCCCTTGAGTGCTGG - Intergenic
1056865104 9:90222022-90222044 GGCCTCACCCCCTTGCGATGGGG - Intergenic
1056917923 9:90760864-90760886 GGCCTCACCCCCCTGCGATGGGG + Intergenic
1060759693 9:126236826-126236848 GTCCTCCCCTCCTTGAATCGGGG + Intergenic
1061411715 9:130425544-130425566 CTCCTCAAGCCCCTGAGTTGGGG + Intronic
1189311051 X:40017864-40017886 GTCCTCTCCTCCTTGAGTTTGGG - Intergenic
1189536371 X:41939312-41939334 TTCCTCATCCCCTTTAGTTTTGG + Intergenic
1191169259 X:57424213-57424235 GTCCTCACGTCCTTCAGTGGTGG - Intronic
1192254258 X:69442641-69442663 TTCCTCTCCCCCTTGAGTGCTGG + Intergenic
1192696373 X:73420277-73420299 GTCTTCTCCCCCTTGAGTGCTGG - Intergenic
1192915511 X:75647066-75647088 AGCCCCACCCCCTTGAGTTGTGG - Intergenic
1196932703 X:120696837-120696859 GTCCTCTCCCCCTTAAGTGCTGG - Intergenic
1198614438 X:138440552-138440574 TCCCTCACCCTCTTGTGTTGAGG + Intergenic