ID: 1081831888

View in Genome Browser
Species Human (GRCh38)
Location 11:46121470-46121492
Sequence GCCCGGGGATCCCTCCGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081831874_1081831888 14 Left 1081831874 11:46121433-46121455 CCACCCGGCCCCGGGCCGCAGCA No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831879_1081831888 4 Left 1081831879 11:46121443-46121465 CCGGGCCGCAGCACCTCCGCCGC No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831873_1081831888 21 Left 1081831873 11:46121426-46121448 CCATTCACCACCCGGCCCCGGGC No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831869_1081831888 26 Left 1081831869 11:46121421-46121443 CCAGCCCATTCACCACCCGGCCC No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831877_1081831888 6 Left 1081831877 11:46121441-46121463 CCCCGGGCCGCAGCACCTCCGCC No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831867_1081831888 29 Left 1081831867 11:46121418-46121440 CCACCAGCCCATTCACCACCCGG No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831875_1081831888 11 Left 1081831875 11:46121436-46121458 CCCGGCCCCGGGCCGCAGCACCT No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831876_1081831888 10 Left 1081831876 11:46121437-46121459 CCGGCCCCGGGCCGCAGCACCTC No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831871_1081831888 22 Left 1081831871 11:46121425-46121447 CCCATTCACCACCCGGCCCCGGG No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831878_1081831888 5 Left 1081831878 11:46121442-46121464 CCCGGGCCGCAGCACCTCCGCCG No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831884_1081831888 -9 Left 1081831884 11:46121456-46121478 CCTCCGCCGCCTCAGCCCGGGGA No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data
1081831880_1081831888 -1 Left 1081831880 11:46121448-46121470 CCGCAGCACCTCCGCCGCCTCAG No data
Right 1081831888 11:46121470-46121492 GCCCGGGGATCCCTCCGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081831888 Original CRISPR GCCCGGGGATCCCTCCGCCC AGG Intergenic
No off target data available for this crispr